Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8197Btlr/Mmmh
Stock Number:
067620-MU
Citation ID:
RRID:MMRRC_067620-MU
Other Names:
R8197 (G1)
Major Collection:

Strain Information

B4galt5
Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5
Synonyms: 9430078I07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56336
HGNC: HGNC:928
Homologene: 3507
Pdyn
Name: prodynorphin
Synonyms: Dyn
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18610
HGNC: HGNC:8820
Homologene: 10321
Rps6ka1
Name: ribosomal protein S6 kinase polypeptide 1
Synonyms: Rsk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20111
Homologene: 55703
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Bub1
Name: BUB1, mitotic checkpoint serine/threonine kinase
Synonyms: Bub1a, D2Xrf87
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12235
HGNC: HGNC:1148
Homologene: 37910
Supt16
Name: SPT16, facilitates chromatin remodeling subunit
Synonyms: Cdc68, Fact140, Spt16, Supt16h
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 114741
VEGA: 14
Homologene: 5207
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 52,489,968 bp
  • T to C, chromosome 1 at 65,073,206 bp
  • A to G, chromosome 1 at 181,690,101 bp
  • G to T, chromosome 1 at 182,748,759 bp
  • T to C, chromosome 2 at 62,372,827 bp
  • T to C, chromosome 2 at 111,096,576 bp
  • A to T, chromosome 2 at 127,364,658 bp
  • G to T, chromosome 2 at 127,801,257 bp
  • C to T, chromosome 2 at 129,688,357 bp
  • A to T, chromosome 2 at 150,267,657 bp
  • T to A, chromosome 2 at 167,302,103 bp
  • T to G, chromosome 3 at 10,194,827 bp
  • T to G, chromosome 4 at 112,894,843 bp
  • T to C, chromosome 4 at 133,865,362 bp
  • A to G, chromosome 5 at 96,834,792 bp
  • A to G, chromosome 6 at 69,963,857 bp
  • A to G, chromosome 6 at 121,413,012 bp
  • G to A, chromosome 7 at 21,272,926 bp
  • A to G, chromosome 7 at 45,442,924 bp
  • CGGCGGCGG to CGGCGGCGGGGGCGGCGG, chromosome 7 at 97,579,914 bp
  • T to A, chromosome 7 at 109,808,477 bp
  • T to A, chromosome 7 at 133,647,359 bp
  • A to G, chromosome 7 at 139,913,531 bp
  • T to C, chromosome 8 at 71,290,963 bp
  • T to A, chromosome 8 at 84,912,821 bp
  • T to A, chromosome 8 at 111,053,996 bp
  • T to A, chromosome 8 at 112,570,225 bp
  • G to T, chromosome 8 at 113,754,595 bp
  • C to A, chromosome 9 at 27,086,033 bp
  • G to A, chromosome 9 at 38,775,281 bp
  • T to A, chromosome 10 at 64,088,516 bp
  • T to A, chromosome 10 at 85,098,237 bp
  • T to C, chromosome 10 at 89,662,366 bp
  • A to G, chromosome 11 at 50,199,780 bp
  • G to A, chromosome 11 at 73,120,384 bp
  • A to G, chromosome 11 at 96,916,149 bp
  • A to C, chromosome 11 at 110,211,815 bp
  • CACCTGCTTGCAACACACCAGGCTGAACTGGACCT to CACCT, chromosome 11 at 116,457,035 bp
  • T to C, chromosome 13 at 33,667,605 bp
  • T to A, chromosome 13 at 109,948,336 bp
  • G to A, chromosome 14 at 52,174,085 bp
  • T to C, chromosome 15 at 75,864,337 bp
  • T to C, chromosome 16 at 8,409,652 bp
  • T to A, chromosome 16 at 59,027,085 bp
  • T to C, chromosome 17 at 22,559,051 bp
  • A to G, chromosome 17 at 24,880,304 bp
  • A to T, chromosome 17 at 55,897,677 bp
  • A to G, chromosome 18 at 13,021,929 bp
  • T to G, chromosome 19 at 44,524,516 bp
  • T to C, chromosome 19 at 45,794,291 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8197 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067620-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.