Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8203Btlr/Mmmh
Stock Number:
067626-MU
Citation ID:
RRID:MMRRC_067626-MU
Other Names:
R8203 (G1)
Major Collection:

Strain Information

Atrn
Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11990
HGNC: HGNC:885
Homologene: 22542
Cltc
Name: clathrin heavy chain
Synonyms: CHC
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Rab3gap2
Name: RAB3 GTPase activating protein subunit 2
Synonyms: 1110059F07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98732
Homologene: 40842
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, E330027G05Rik, 6620402G01Rik, 9430077C05Rik, Skt, Sickle tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Atf7ip
Name: activating transcription factor 7 interacting protein
Synonyms: ATFa-associated Modulator, AM, 2610204M12Rik, Mcaf1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54343
Homologene: 10051
Cep170
Name: centrosomal protein 170
Synonyms: 4933426L22Rik, A330004A13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545389
Homologene: 22844
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC to CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC, chromosome 1 at 174,609,203 bp
  • T to A, chromosome 1 at 176,769,311 bp
  • T to C, chromosome 1 at 185,267,179 bp
  • A to T, chromosome 2 at 20,785,105 bp
  • G to A, chromosome 2 at 23,164,526 bp
  • A to G, chromosome 2 at 28,672,995 bp
  • A to G, chromosome 2 at 29,935,510 bp
  • T to A, chromosome 2 at 52,149,247 bp
  • T to A, chromosome 2 at 86,162,500 bp
  • T to A, chromosome 2 at 113,525,275 bp
  • G to A, chromosome 2 at 120,519,078 bp
  • G to A, chromosome 2 at 130,960,549 bp
  • T to C, chromosome 2 at 180,464,799 bp
  • A to T, chromosome 3 at 51,530,098 bp
  • A to T, chromosome 3 at 59,328,833 bp
  • A to G, chromosome 4 at 46,606,476 bp
  • A to T, chromosome 4 at 134,279,365 bp
  • A to G, chromosome 4 at 148,612,142 bp
  • G to T, chromosome 4 at 150,158,558 bp
  • G to C, chromosome 5 at 136,697,971 bp
  • A to G, chromosome 6 at 34,799,479 bp
  • A to G, chromosome 6 at 43,280,645 bp
  • T to C, chromosome 6 at 122,561,117 bp
  • A to G, chromosome 6 at 126,894,834 bp
  • T to C, chromosome 6 at 136,606,783 bp
  • G to A, chromosome 7 at 56,773,260 bp
  • A to T, chromosome 7 at 140,336,026 bp
  • A to G, chromosome 9 at 19,137,874 bp
  • T to C, chromosome 9 at 44,514,154 bp
  • T to G, chromosome 9 at 71,479,486 bp
  • T to C, chromosome 9 at 79,681,549 bp
  • A to T, chromosome 9 at 121,168,208 bp
  • A to T, chromosome 11 at 46,150,320 bp
  • A to G, chromosome 11 at 51,779,697 bp
  • A to C, chromosome 11 at 73,214,078 bp
  • A to T, chromosome 11 at 86,704,160 bp
  • G to A, chromosome 11 at 89,050,367 bp
  • G to T, chromosome 11 at 97,566,713 bp
  • GTAGTGTATA to GTA, chromosome 12 at 85,803,148 bp
  • A to G, chromosome 12 at 87,268,268 bp
  • T to A, chromosome 12 at 112,025,630 bp
  • T to C, chromosome 13 at 100,425,820 bp
  • T to A, chromosome 14 at 56,467,722 bp
  • T to C, chromosome 15 at 25,414,441 bp
  • A to G, chromosome 15 at 91,191,166 bp
  • T to A, chromosome 17 at 15,020,286 bp
  • C to A, chromosome 17 at 26,266,359 bp
  • G to T, chromosome 18 at 32,852,083 bp
  • G to C, chromosome 18 at 60,829,051 bp
  • A to T, chromosome 19 at 29,716,043 bp
  • A to G, chromosome 19 at 33,966,883 bp
  • A to T, chromosome 19 at 39,881,140 bp
  • T to C, chromosome Y at 1,269,827 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8203 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067626-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.