Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8203Btlr/Mmmh
Stock Number:
067626-MU
Citation ID:
RRID:MMRRC_067626-MU
Other Names:
R8203 (G1)
Major Collection:

Strain Information

Atrn
Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11990
HGNC: HGNC:885
Homologene: 22542
Cltc
Name: clathrin heavy chain
Synonyms: CHC
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Rab3gap2
Name: RAB3 GTPase activating protein subunit 2
Synonyms: 1110059F07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98732
Homologene: 40842
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, E330027G05Rik, 6620402G01Rik, 9430077C05Rik, Skt, Sickle tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Atf7ip
Name: activating transcription factor 7 interacting protein
Synonyms: ATFa-associated Modulator, AM, 2610204M12Rik, Mcaf1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54343
Homologene: 10051
Cep170
Name: centrosomal protein 170
Synonyms: 4933426L22Rik, A330004A13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545389
Homologene: 22844
Zfp106
Name: zinc finger protein 106
Synonyms: Cd-1, H3a, sirm, Sh3bp3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20402
Homologene: 40787
Tcof1
Name: treacle ribosome biogenesis factor 1
Synonyms: treacle
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 21453
Homologene: 68049
Rnf17
Name: ring finger protein 17
Synonyms: MMIP-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 30054
VEGA: 14
Homologene: 23727
Pdik1l
Name: PDLIM1 interacting kinase 1 like
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230809
Homologene: 36977
Ermard
Name: ER membrane associated RNA degradation
Synonyms: 2410011O22Rik, 2210404J11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381062
Homologene: 19936
Ddx3y
Name: DEAD box helicase 3, Y-linked
Synonyms: Dby, 8030469F12Rik, D1Pas1-rs1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 26900
HGNC: HGNC:2699
Homologene: 55839
Yme1l1
Name: YME1-like 1 (S. cerevisiae)
Synonyms: Ftsh, ATP-dependent metalloprotease FtsH1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27377
Homologene: 31996
Dgke
Name: diacylglycerol kinase, epsilon
Synonyms: DAGK6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56077
HGNC: HGNC:2852
Homologene: 2705
Luc7l
Name: Luc7-like
Synonyms: 2410018D03Rik, 1810045C04Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66978
HGNC: HGNC:6723
Homologene: 100558
Wdr36
Name: WD repeat domain 36
Synonyms: 5730444A13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225348
VEGA: 18
Homologene: 6536
Gle1
Name: GLE1 RNA export mediator
Synonyms: 4933405K21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74412
HGNC: HGNC:4315
Homologene: 20379
Tsc1
Name: TSC complex subunit 1
Synonyms: hamartin, tuberous sclerosis 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64930
Homologene: 314
Ahsa1
Name: AHA1, activator of heat shock protein ATPase 1
Synonyms: p38, Aha1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217737
VEGA: 12
HGNC: HGNC:1189
Homologene: 8106
Tbc1d2
Name: TBC1 domain family, member 2
Synonyms: LOC381605, PARIS-1, PARIS1, A630005A06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381605
Homologene: 10190
Col12a1
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12816
HGNC: HGNC:2188
Homologene: 3217
Brd10
Name: bromodomain containing 10
Synonyms: Gm9832, 9930021J03Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240613
Homologene: 19046
Ulk4
Name: unc-51-like kinase 4
Synonyms: 4932415A06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209012
Homologene: 41205
Agbl3
Name: ATP/GTP binding protein-like 3
Synonyms: 2900053G10Rik, 6530406M24Rik, 4930431N21Rik, Ccp3, Ccp3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76223
Homologene: 35330
Arhgef5
Name: Rho guanine nucleotide exchange factor 5
Synonyms: 2210412D05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54324
Homologene: 66300
Naip1
Name: NLR family, apoptosis inhibitory protein 1
Synonyms: D13Lsd1, Naip, Birc1a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17940
VEGA: 13
HGNC: HGNC:7634
Homologene: 113589
Igsf10
Name: immunoglobulin superfamily, member 10
Synonyms: 6530405F15Rik, CMF608, Adlican2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242050
Homologene: 18712
Slc2a7
Name: solute carrier family 2 (facilitated glucose transporter), member 7
Synonyms: OTTMUSG00000010396
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 435818
Homologene: 72470
Shpk
Name: sedoheptulokinase
Synonyms: 4930431K22Rik, Carkl
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74637
HGNC: HGNC:1492
Homologene: 8319
Nipal4
Name: NIPA-like domain containing 4
Synonyms: 9530066K23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 214112
Homologene: 133769
Gabrg3
Name: gamma-aminobutyric acid type A receptor, subunit gamma 3
Synonyms: Gabrg-3, B230362M20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14407
HGNC: HGNC:4088
Homologene: 22444
Or5al7
Name: olfactory receptor family 5 subfamily AL member 7
Synonyms: GA_x6K02T2Q125-47631900-47630956, MOR185-7, Olfr1043
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258570
Homologene: 88364
Cxcr5
Name: C-X-C motif chemokine receptor 5
Synonyms: Gpcr6, CXCR-5, Blr1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12145
VEGA: 9
HGNC: HGNC:1060
Homologene: 1298
Setd7
Name: SET domain containing (lysine methyltransferase) 7
Synonyms: 1600028F23Rik, Set7, KMT7, Set7/9
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73251
Homologene: 12741
Masp2
Name: MBL associated serine protease 2
Synonyms: MAp19, MASP-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17175
HGNC: HGNC:6902
Homologene: 4819
Tdrd9
Name: tudor domain containing 9
Synonyms: 4930441E05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74691
Homologene: 14311
Abcd2
Name: ATP-binding cassette, sub-family D member 2
Synonyms: ALDR, ALDL1, adrenoleukodystrophy related, ABC39
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 26874
VEGA: 15
HGNC: HGNC:66
Homologene: 55873
Cyp2c69
Name: cytochrome P450, family 2, subfamily c, polypeptide 69
Synonyms: AI098658
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 100043108
VEGA: 19
Homologene: 74936
Dyrk4
Name: dual-specificity tyrosine phosphorylation regulated kinase 4
Synonyms: Dyrk4b, Dyrk4a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101320
HGNC: HGNC:3095
Homologene: 37858
Or12j2
Name: olfactory receptor family 12 subfamily J member 2
Synonyms: GA_x6K02T2PBJ9-42486061-42486978, MOR251-5, Olfr527
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257939
Homologene: 73958
Aicda
Name: activation-induced cytidine deaminase
Synonyms: Aid
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11628
Homologene: 7623
Lipf
Name: lipase, gastric
Synonyms: 2310051B21Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67717
HGNC: HGNC:6622
Homologene: 68139
Polr2m
Name: polymerase (RNA) II (DNA directed) polypeptide M
Synonyms: D9Wsu138e, Grinl1a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 28015
Homologene: 9181
Srcin1
Name: SRC kinase signaling inhibitor 1
Synonyms: P140, p140Cap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56013
Homologene: 10324
Slco4a1
Name: solute carrier organic anion transporter family, member 4a1
Synonyms: OATP-E, Slc21a12
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108115
Homologene: 9482
Or7g22
Name: olfactory receptor family 7 subfamily G member 22
Synonyms: GA_x6K02T2PVTD-12873838-12874776, MOR152-2, Olfr837
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258558
HGNC: HGNC:8466
Homologene: 115507
Sar1b
Name: secretion associated Ras related GTPase 1B
Synonyms: 2900019I22Rik, 2310075M17Rik, Sara2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66397
Homologene: 90905
Gm5468
Name: predicted gene 5468
Synonyms: 100040583, Gm48957
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 432939
VEGA: 15
Myl10
Name: myosin, light chain 10, regulatory
Synonyms: PLRLC-C, PLRLC-B, PLRLC-A, PLRLC, 1700027I08Rik, Mylc2pl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 59310
Homologene: 69341
Mfsd7c
Name:
Type: Gene
Species: Mouse
Chromosome: 12
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC to CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC, chromosome 1 at 174,609,203 bp
  • T to A, chromosome 1 at 176,769,311 bp
  • T to C, chromosome 1 at 185,267,179 bp
  • A to T, chromosome 2 at 20,785,105 bp
  • G to A, chromosome 2 at 23,164,526 bp
  • A to G, chromosome 2 at 28,672,995 bp
  • A to G, chromosome 2 at 29,935,510 bp
  • T to A, chromosome 2 at 52,149,247 bp
  • T to A, chromosome 2 at 86,162,500 bp
  • T to A, chromosome 2 at 113,525,275 bp
  • G to A, chromosome 2 at 120,519,078 bp
  • G to A, chromosome 2 at 130,960,549 bp
  • T to C, chromosome 2 at 180,464,799 bp
  • A to T, chromosome 3 at 51,530,098 bp
  • A to T, chromosome 3 at 59,328,833 bp
  • A to G, chromosome 4 at 46,606,476 bp
  • A to T, chromosome 4 at 134,279,365 bp
  • A to G, chromosome 4 at 148,612,142 bp
  • G to T, chromosome 4 at 150,158,558 bp
  • G to C, chromosome 5 at 136,697,971 bp
  • A to G, chromosome 6 at 34,799,479 bp
  • A to G, chromosome 6 at 43,280,645 bp
  • T to C, chromosome 6 at 122,561,117 bp
  • A to G, chromosome 6 at 126,894,834 bp
  • T to C, chromosome 6 at 136,606,783 bp
  • G to A, chromosome 7 at 56,773,260 bp
  • A to T, chromosome 7 at 140,336,026 bp
  • A to G, chromosome 9 at 19,137,874 bp
  • T to C, chromosome 9 at 44,514,154 bp
  • T to G, chromosome 9 at 71,479,486 bp
  • T to C, chromosome 9 at 79,681,549 bp
  • A to T, chromosome 9 at 121,168,208 bp
  • A to T, chromosome 11 at 46,150,320 bp
  • A to G, chromosome 11 at 51,779,697 bp
  • A to C, chromosome 11 at 73,214,078 bp
  • A to T, chromosome 11 at 86,704,160 bp
  • G to A, chromosome 11 at 89,050,367 bp
  • G to T, chromosome 11 at 97,566,713 bp
  • GTAGTGTATA to GTA, chromosome 12 at 85,803,148 bp
  • A to G, chromosome 12 at 87,268,268 bp
  • T to A, chromosome 12 at 112,025,630 bp
  • T to C, chromosome 13 at 100,425,820 bp
  • T to A, chromosome 14 at 56,467,722 bp
  • T to C, chromosome 15 at 25,414,441 bp
  • A to G, chromosome 15 at 91,191,166 bp
  • T to A, chromosome 17 at 15,020,286 bp
  • C to A, chromosome 17 at 26,266,359 bp
  • G to T, chromosome 18 at 32,852,083 bp
  • G to C, chromosome 18 at 60,829,051 bp
  • A to T, chromosome 19 at 29,716,043 bp
  • A to G, chromosome 19 at 33,966,883 bp
  • A to T, chromosome 19 at 39,881,140 bp
  • T to C, chromosome Y at 1,269,827 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8203 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067626-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.