Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8236Btlr/Mmmh
Stock Number:
067668-MU
Citation ID:
RRID:MMRRC_067668-MU
Other Names:
R8236 (G1)
Major Collection:

Strain Information

Aven
Name: apoptosis, caspase activation inhibitor
Synonyms: 1700013A01Rik, mAven-S, mAven-L, 1700056A21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74268
Homologene: 10683
Epyc
Name: epiphycan
Synonyms: PG-Lb, epiphycan, SLRR3B, Dspg3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13516
HGNC: HGNC:3053
Homologene: 3634
Slc2a1
Name: solute carrier family 2 (facilitated glucose transporter), member 1
Synonyms: Glut-1, Glut1, M100200, Rgsc200
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20525
Homologene: 68520
Fgfr1
Name: fibroblast growth factor receptor 1
Synonyms: Flt-2, Fgfr-1, Hspy, Eask, FGFR-I, Fr1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14182
HGNC: HGNC:3688
Homologene: 69065
Smyd3
Name: SET and MYND domain containing 3
Synonyms: Zmynd1, 2410008A19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69726
Homologene: 41491
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Gphn
Name: gephyrin
Synonyms: geph, 5730552E08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268566
VEGA: 12
Homologene: 10820
Cdk5rap2
Name: CDK5 regulatory subunit associated protein 2
Synonyms: 2900018K03Rik, an
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214444
Homologene: 49533
Mical3
Name: microtubule associated monooxygenase, calponin and LIM domain containing 3
Synonyms: MICAL-3, C130040D16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 194401
Homologene: 85288
Ankfy1
Name: ankyrin repeat and FYVE domain containing 1
Synonyms: Ankhzn
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11736
Homologene: 9491
Tet2
Name: tet methylcytosine dioxygenase 2
Synonyms: E130014J05Rik, Ayu17-449
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214133
Homologene: 49498
Rtf1
Name: RTF1, Paf1/RNA polymerase II complex component
Synonyms: 6530416A09Rik, 2900005O08Rik, Gtl7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76246
Homologene: 133868
Hook1
Name: hook microtubule tethering protein 1
Synonyms: abnormal spermatozoon head shape, azh, A930033L17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77963
Homologene: 9289
Actr8
Name: ARP8 actin-related protein 8
Synonyms: ARP8, 5730542K05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56249
VEGA: 14
Homologene: 11286
Mxi1
Name: MAX interactor 1, dimerization protein
Synonyms: Mad2, bHLHc11
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17859
VEGA: 19
HGNC: HGNC:7534
Homologene: 4351
Sos1
Name: SOS Ras/Rac guanine nucleotide exchange factor 1
Synonyms: 4430401P03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20662
VEGA: 17
Homologene: 4117
Fam171b
Name: family with sequence similarity 171, member B
Synonyms: D430039N05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241520
Homologene: 18462
Dcc
Name: DCC netrin 1 receptor
Synonyms: C030036D22Rik, Igdcc1, deleted in colorectal carcinoma
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13176
HGNC: HGNC:2701
Homologene: 21081
Zranb1
Name: zinc finger, RAN-binding domain containing 1
Synonyms: D7Wsu87e, 9330160G10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 360216
Homologene: 9728
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Ubr2
Name: ubiquitin protein ligase E3 component n-recognin 2
Synonyms: 9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224826
VEGA: 17
Homologene: 26151
Fam135a
Name: family with sequence similarity 135, member A
Synonyms: 4921533L14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68187
Homologene: 32665
Cblb
Name: Casitas B-lineage lymphoma b
Synonyms: Cbl-b
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208650
VEGA: 16
HGNC: HGNC:1542
Homologene: 15856
Brip1
Name: BRCA1 interacting protein C-terminal helicase 1
Synonyms: 8030460J03Rik, BACH1, 3110009N10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237911
Homologene: 32766
Edc4
Name: enhancer of mRNA decapping 4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234699
Homologene: 40937
Flt3
Name: FMS-like tyrosine kinase 3
Synonyms: CD135, Flk-2, Flt-3, Flk2, wmfl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14255
HGNC: HGNC:3765
Homologene: 3040
Ttyh1
Name: tweety family member 1
Synonyms: tty, 6330408P11Rik, 4930459B04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57776
Homologene: 10779
Ptpn4
Name: protein tyrosine phosphatase, non-receptor type 4
Synonyms: hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte), TEP/mPTPMEG, testis-enriched phosphatase, TEP, PTPMEG
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19258
HGNC: HGNC:9656
Homologene: 2120
Ctnnd2
Name: catenin delta 2
Synonyms: Nprap, Catnd2, neurojugin, catenin (cadherin associated protein), delta 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18163
VEGA: 15
HGNC: HGNC:2516
Homologene: 55574
Gdpd3
Name: glycerophosphodiester phosphodiesterase domain containing 3
Synonyms: 1110015E22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68616
Homologene: 23441
Itpr2
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16439
HGNC: HGNC:6181
Homologene: 37593
Trpm3
Name: transient receptor potential cation channel, subfamily M, member 3
Synonyms: B930001P07Rik, 6330504P12Rik, MLSN2, melastatin 2, LTRPC3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226025
VEGA: 19
Homologene: 62287
Col28a1
Name: collagen, type XXVIII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213945
Homologene: 66345
Zfp608
Name: zinc finger protein 608
Synonyms: 4932417D18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269023
VEGA: 18
Homologene: 18485
Afm
Name: afamin
Synonyms: Alf, alpha albumin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 280662
HGNC: HGNC:316
Homologene: 881
Cdt1
Name: chromatin licensing and DNA replication factor 1
Synonyms: 2610318F11Rik, Ris2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67177
Homologene: 32650
Zkscan2
Name: zinc finger with KRAB and SCAN domains 2
Synonyms: 9430065N20Rik, Zfp694
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210162
Homologene: 19671
Or8b54
Name: olfactory receptor family 8 subfamily B member 54
Synonyms: GA_x6K02T2PVTD-32478047-32478988, MOR165-8, Olfr921
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258778
VEGA: 9
Homologene: 128138
Ptprt
Name: protein tyrosine phosphatase receptor type T
Synonyms: RPTPrho
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19281
HGNC: HGNC:9682
Homologene: 56924
Lhcgr
Name: luteinizing hormone/choriogonadotropin receptor
Synonyms: Lhr, Gpcr19-rs1, LH-R
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16867
VEGA: 17
HGNC: HGNC:6585
Homologene: 37276
Ttbk1
Name: tau tubulin kinase 1
Synonyms: C330008L01Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106763
VEGA: 17
Homologene: 50342
Tcam1
Name: testicular cell adhesion molecule 1
Synonyms: 4930570F09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75870
Homologene: 123944
Nanog
Name: Nanog homeobox
Synonyms: 2410002E02Rik, ENK, ecat4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71950
Homologene: 78027
Pip
Name: prolactin induced protein
Synonyms: GCDFP-15, gross cystic disease fluid protein 15, mSMGP
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18716
HGNC: HGNC:8993
Homologene: 1990
Cab39
Name: calcium binding protein 39
Synonyms: 39kDa, MO25alpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12283
Homologene: 69212
Sult1b1
Name: sulfotransferase family 1B, member 1
Synonyms: Dopa/tyrosine sulfotransferase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56362
Homologene: 69169
Or5w14
Name: olfactory receptor family 5 subfamily W member 14
Synonyms: GA_x6K02T2Q125-49215724-49214792, MOR177-20, MOR40-9P, Olfr1137
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258101
Homologene: 79380
Gm4353
Name: predicted gene 4353
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043313
VEGA: 7
Defb30
Name: defensin beta 30
Synonyms: 4930449O14Rik, 2410125J01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 73670
Homologene: 86862
Il9
Name: interleukin 9
Synonyms: Il-9, P40
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16198
VEGA: 13
HGNC: HGNC:6029
Homologene: 492
Tmem30c
Name: transmembrane protein 30C
Synonyms: 4933409A18Rik, 4933401B01Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71027
Homologene: 78138
Gm10110
Name: predicted gene 10110
Type: Gene
Species: Mouse
Chromosome: 14
Psmd6
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Synonyms: 2400006A19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66413
HGNC: HGNC:9564
Homologene: 7157
Coro2a
Name: coronin, actin binding protein 2A
Synonyms: coronin 4, IR10, 9030208C03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107684
HGNC: HGNC:2255
Homologene: 2546
Trem2
Name: triggering receptor expressed on myeloid cells 2
Synonyms: Trem2c, Trem2b, Trem2a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 83433
Homologene: 10352
Ppp2r3d
Name: protein phosphatase 2 (formerly 2A), regulatory subunit B'', delta
Synonyms: PR59, Ppp2r3, Ppp2r3a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19054
Mup10
Name: major urinary protein 10
Synonyms: 2610016E04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100039008
Homologene: 74304
Gm43518
Name: predicted gene 43518
Type: Gene
Species: Mouse
Chromosome: 5
Ccdc64
Name:
Type: Gene
Species: Mouse
Chromosome: 5
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 24,020,648 bp
  • T to C, chromosome 1 at 85,848,371 bp
  • C to T, chromosome 1 at 86,046,393 bp
  • A to G, chromosome 1 at 119,678,822 bp
  • A to C, chromosome 1 at 179,405,640 bp
  • G to A, chromosome 2 at 83,880,206 bp
  • T to A, chromosome 2 at 87,711,760 bp
  • C to T, chromosome 2 at 112,559,775 bp
  • T to C, chromosome 2 at 119,701,214 bp
  • C to T, chromosome 2 at 161,687,068 bp
  • G to A, chromosome 3 at 133,487,786 bp
  • A to G, chromosome 4 at 46,548,796 bp
  • A to G, chromosome 4 at 60,581,563 bp
  • G to T, chromosome 4 at 70,242,485 bp
  • T to A, chromosome 4 at 96,014,805 bp
  • G to C, chromosome 4 at 119,133,257 bp
  • G to A, chromosome 4 at 152,149,030 bp
  • G to T, chromosome 5 at 87,521,524 bp
  • A to T, chromosome 5 at 90,523,888 bp
  • T to C, chromosome 5 at 115,649,559 bp
  • C to T, chromosome 5 at 123,934,222 bp
  • A to G, chromosome 5 at 147,356,860 bp
  • A to G, chromosome 6 at 8,097,024 bp
  • A to G, chromosome 6 at 41,847,662 bp
  • A to G, chromosome 6 at 121,012,543 bp
  • A to T, chromosome 6 at 122,713,172 bp
  • A to G, chromosome 6 at 146,390,783 bp
  • G to A, chromosome 7 at 4,125,548 bp
  • T to C, chromosome 7 at 116,083,383 bp
  • A to G, chromosome 7 at 123,479,912 bp
  • A to G, chromosome 7 at 126,768,666 bp
  • T to C, chromosome 7 at 132,949,664 bp
  • G to T, chromosome 8 at 25,562,272 bp
  • A to G, chromosome 8 at 105,892,273 bp
  • A to G, chromosome 8 at 122,572,028 bp
  • C to A, chromosome 9 at 7,080,363 bp
  • G to A, chromosome 9 at 38,775,281 bp
  • T to C, chromosome 9 at 124,440,067 bp
  • A to T, chromosome 10 at 97,681,205 bp
  • T to A, chromosome 11 at 72,754,355 bp
  • C to A, chromosome 11 at 86,139,112 bp
  • A to G, chromosome 11 at 106,286,417 bp
  • A to G, chromosome 12 at 78,664,537 bp
  • T to A, chromosome 13 at 56,482,245 bp
  • GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC to GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC, chromosome 14 at 14,119,882 bp
  • A to G, chromosome 14 at 29,982,628 bp
  • A to T, chromosome 14 at 63,049,767 bp
  • C to T, chromosome 14 at 89,898,241 bp
  • G to A, chromosome 15 at 30,647,018 bp
  • C to A, chromosome 16 at 52,166,029 bp
  • T to C, chromosome 16 at 57,276,179 bp
  • T to G, chromosome 17 at 46,470,729 bp
  • T to C, chromosome 17 at 46,951,909 bp
  • G to T, chromosome 17 at 48,351,906 bp
  • G to C, chromosome 17 at 74,611,131 bp
  • T to C, chromosome 17 at 80,408,283 bp
  • A to T, chromosome 17 at 88,742,586 bp
  • T to A, chromosome 18 at 54,899,209 bp
  • C to T, chromosome 18 at 71,955,018 bp
  • C to A, chromosome 19 at 22,987,408 bp
  • C to G, chromosome 19 at 53,369,598 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8236 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067668-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.