Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8236Btlr/Mmmh
Stock Number:
067668-MU
Citation ID:
RRID:MMRRC_067668-MU
Other Names:
R8236 (G1)
Major Collection:

Strain Information

Aven
Name: apoptosis, caspase activation inhibitor
Synonyms: 1700013A01Rik, mAven-S, mAven-L, 1700056A21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74268
Homologene: 10683
Epyc
Name: epiphycan
Synonyms: PG-Lb, epiphycan, SLRR3B, Dspg3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13516
HGNC: HGNC:3053
Homologene: 3634
Slc2a1
Name: solute carrier family 2 (facilitated glucose transporter), member 1
Synonyms: Glut-1, Glut1, M100200, Rgsc200
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20525
Homologene: 68520
Fgfr1
Name: fibroblast growth factor receptor 1
Synonyms: Flt-2, Fgfr-1, Hspy, Eask, FGFR-I, Fr1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14182
HGNC: HGNC:3688
Homologene: 69065
Smyd3
Name: SET and MYND domain containing 3
Synonyms: Zmynd1, 2410008A19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69726
Homologene: 41491
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Gphn
Name: gephyrin
Synonyms: geph, 5730552E08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268566
VEGA: 12
Homologene: 10820
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 24,020,648 bp
  • T to C, chromosome 1 at 85,848,371 bp
  • C to T, chromosome 1 at 86,046,393 bp
  • A to G, chromosome 1 at 119,678,822 bp
  • A to C, chromosome 1 at 179,405,640 bp
  • G to A, chromosome 2 at 83,880,206 bp
  • T to A, chromosome 2 at 87,711,760 bp
  • C to T, chromosome 2 at 112,559,775 bp
  • T to C, chromosome 2 at 119,701,214 bp
  • C to T, chromosome 2 at 161,687,068 bp
  • G to A, chromosome 3 at 133,487,786 bp
  • A to G, chromosome 4 at 46,548,796 bp
  • A to G, chromosome 4 at 60,581,563 bp
  • G to T, chromosome 4 at 70,242,485 bp
  • T to A, chromosome 4 at 96,014,805 bp
  • G to C, chromosome 4 at 119,133,257 bp
  • G to A, chromosome 4 at 152,149,030 bp
  • G to T, chromosome 5 at 87,521,524 bp
  • A to T, chromosome 5 at 90,523,888 bp
  • T to C, chromosome 5 at 115,649,559 bp
  • C to T, chromosome 5 at 123,934,222 bp
  • A to G, chromosome 5 at 147,356,860 bp
  • A to G, chromosome 6 at 8,097,024 bp
  • A to G, chromosome 6 at 41,847,662 bp
  • A to G, chromosome 6 at 121,012,543 bp
  • A to T, chromosome 6 at 122,713,172 bp
  • A to G, chromosome 6 at 146,390,783 bp
  • G to A, chromosome 7 at 4,125,548 bp
  • T to C, chromosome 7 at 116,083,383 bp
  • A to G, chromosome 7 at 123,479,912 bp
  • A to G, chromosome 7 at 126,768,666 bp
  • T to C, chromosome 7 at 132,949,664 bp
  • G to T, chromosome 8 at 25,562,272 bp
  • A to G, chromosome 8 at 105,892,273 bp
  • A to G, chromosome 8 at 122,572,028 bp
  • C to A, chromosome 9 at 7,080,363 bp
  • G to A, chromosome 9 at 38,775,281 bp
  • T to C, chromosome 9 at 124,440,067 bp
  • A to T, chromosome 10 at 97,681,205 bp
  • T to A, chromosome 11 at 72,754,355 bp
  • C to A, chromosome 11 at 86,139,112 bp
  • A to G, chromosome 11 at 106,286,417 bp
  • A to G, chromosome 12 at 78,664,537 bp
  • T to A, chromosome 13 at 56,482,245 bp
  • GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC to GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC, chromosome 14 at 14,119,882 bp
  • A to G, chromosome 14 at 29,982,628 bp
  • A to T, chromosome 14 at 63,049,767 bp
  • C to T, chromosome 14 at 89,898,241 bp
  • G to A, chromosome 15 at 30,647,018 bp
  • C to A, chromosome 16 at 52,166,029 bp
  • T to C, chromosome 16 at 57,276,179 bp
  • T to G, chromosome 17 at 46,470,729 bp
  • T to C, chromosome 17 at 46,951,909 bp
  • G to T, chromosome 17 at 48,351,906 bp
  • G to C, chromosome 17 at 74,611,131 bp
  • T to C, chromosome 17 at 80,408,283 bp
  • A to T, chromosome 17 at 88,742,586 bp
  • T to A, chromosome 18 at 54,899,209 bp
  • C to T, chromosome 18 at 71,955,018 bp
  • C to A, chromosome 19 at 22,987,408 bp
  • C to G, chromosome 19 at 53,369,598 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8236 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067668-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.