Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8240Btlr/Mmmh
Stock Number:
067671-MU
Citation ID:
RRID:MMRRC_067671-MU
Other Names:
R8240 (G1)
Major Collection:

Strain Information

P2rx7
Name: purinergic receptor P2X, ligand-gated ion channel, 7
Synonyms: P2X7 receptor, P2X7R, P2X(7)
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18439
HGNC: HGNC:8537
Homologene: 1925
Slc44a2
Name: solute carrier family 44, member 2
Synonyms: 1110028E10Rik, CTL2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68682
VEGA: 9
Homologene: 10711
Ncoa7
Name: nuclear receptor coactivator 7
Synonyms: 9030406N13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 211329
VEGA: 10
Homologene: 65245
Zmym4
Name: zinc finger, MYM-type 4
Synonyms: 6330503C17Rik, Zfp262
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67785
Homologene: 35470
Coro7
Name: coronin 7
Synonyms: 0610011B16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78885
Homologene: 11573
Zfp160
Name: zinc finger protein 160
Synonyms: 6720480D16Rik, 6720480D16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224585
VEGA: 17
Homologene: 137372
Tasor2
Name: transcription activation suppressor family member 2
Synonyms: BC016423, Fam208b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105203
VEGA: 13
Homologene: 26435
Frem1
Name: Fras1 related extracellular matrix protein 1
Synonyms: eyem02Jus, heb, QBRICK, crf11, eyes2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329872
Homologene: 27049
Rtn4r
Name: reticulon 4 receptor
Synonyms: Nogo-66 receptor, NgR, NgR1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 65079
Homologene: 11299
Clca4a
Name: chloride channel accessory 4A
Synonyms: 9130020L07Rik, Clca6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99663
HGNC: HGNC:2018
Homologene: 40808
Hibch
Name: 3-hydroxyisobutyryl-Coenzyme A hydrolase
Synonyms: HIBYL-COA-H, 2610509I15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227095
HGNC: HGNC:4908
Homologene: 5607
Baiap3
Name: BAI1-associated protein 3
Synonyms: LOC381076
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 545192
HGNC: HGNC:948
Homologene: 20844
Klhl8
Name: kelch-like 8
Synonyms: 2310001P09Rik, D5Ertd431e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 246293
Homologene: 10819
Col24a1
Name: collagen, type XXIV, alpha 1
Synonyms: 5430404K19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71355
Homologene: 65061
Plcd4
Name: phospholipase C, delta 4
Synonyms: 4921507K24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18802
HGNC: HGNC:9062
Homologene: 88782
Cfap206
Name: cilia and flagella associated protein 206
Synonyms: 1700003M02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69329
Homologene: 18713
Zfp458
Name: zinc finger protein 458
Synonyms: Rslcan-7
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238690
VEGA: 13
Homologene: 128170
Ahnak2
Name: AHNAK nucleoprotein 2
Synonyms: LOC382643
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100041194
Homologene: 131081
Cct6b
Name: chaperonin containing TCP1 subunit 6B
Synonyms: CCTzeta-2, Cctz-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12467
HGNC: HGNC:1621
Homologene: 55978
Nhsl1
Name: NHS like 1
Synonyms: A630035H13Rik, D10Bwg0940e, 5730409E15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215819
Homologene: 27834
Trim30a
Name: tripartite motif-containing 30A
Synonyms: Rpt-1, Rpt1, Trim30
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20128
Homologene: 114426
Myh3
Name: myosin, heavy polypeptide 3, skeletal muscle, embryonic
Synonyms: MyHC-emb, Myhs-e, Myhse
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17883
HGNC: HGNC:7573
Homologene: 20553
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243369
Homologene: 45453
Or10p21
Name: olfactory receptor family 10 subfamily P member 21
Synonyms: GA_x6K02T2PULF-10696986-10697915, MOR269-2, Olfr763
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258861
Homologene: 85121
Spag6l
Name: sperm associated antigen 6-like
Synonyms: PF16, Spag6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 50525
Homologene: 8252
Il1rap
Name: interleukin 1 receptor accessory protein
Synonyms: IL-1R AcP, IL-1RAcP, 6430709H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16180
HGNC: HGNC:5995
Homologene: 1643
Itm2c
Name: integral membrane protein 2C
Synonyms: BRI3, 3110038L02Rik, ITM3, Bricd2c
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 64294
HGNC: HGNC:6175
Homologene: 11186
Prps1l1
Name: phosphoribosyl pyrophosphate synthetase 1-like 1
Synonyms: 1700011K15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75456
HGNC: HGNC:9463
Homologene: 75282
Hcn1
Name: hyperpolarization activated cyclic nucleotide gated potassium channel 1
Synonyms: HAC2, Bcng1, C630013B14Rik, hyperpolarization-activated, cyclic nucleotide-gated K+ 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15165
HGNC: HGNC:4845
Homologene: 32093
Cyp3a44
Name: cytochrome P450, family 3, subfamily a, polypeptide 44
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 337924
HGNC: HGNC:2638
Homologene: 133568
Tjp3
Name: tight junction protein 3
Synonyms: ZO-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27375
VEGA: 10
Homologene: 8458
Ttll1
Name: tubulin tyrosine ligase-like 1
Synonyms: 6330444E16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 319953
HGNC: HGNC:1312
Homologene: 8174
Or4a15
Name: olfactory receptor family 4 subfamily A member 15
Synonyms: GA_x6K02T2Q125-50805620-50804676, MOR231-2, Olfr1234
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258975
Homologene: 128156
Gstm6
Name: glutathione S-transferase, mu 6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14867
Homologene: 117950
Slc43a1
Name: solute carrier family 43, member 1
Synonyms: PB39, 2610016F07Rik, Pov1, Lat3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72401
HGNC: HGNC:9225
Homologene: 2688
Prss27
Name: serine protease 27
Synonyms: marapsin, CAPH2, Mpn, Pancreasin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213171
Homologene: 23743
Mcee
Name: methylmalonyl CoA epimerase
Synonyms: 1110007A04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73724
Homologene: 13078
Tmsb10b
Name: thymosin beta 10b
Synonyms: Gm9844
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043712
2610524H06Rik
Name: RIKEN cDNA 2610524H06 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330173
Homologene: 138452
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 52,901,335 bp
  • C to G, chromosome 1 at 74,554,501 bp
  • G to T, chromosome 1 at 85,894,736 bp
  • A to G, chromosome 2 at 84,859,823 bp
  • C to T, chromosome 2 at 89,362,552 bp
  • T to A, chromosome 3 at 107,942,137 bp
  • T to C, chromosome 3 at 144,970,727 bp
  • A to T, chromosome 3 at 145,507,702 bp
  • A to G, chromosome 4 at 34,728,902 bp
  • T to A, chromosome 4 at 82,956,248 bp
  • A to T, chromosome 4 at 126,904,395 bp
  • C to T, chromosome 5 at 103,867,526 bp
  • A to T, chromosome 5 at 114,823,411 bp
  • C to T, chromosome 5 at 122,655,033 bp
  • G to A, chromosome 5 at 145,788,447 bp
  • A to T, chromosome 6 at 48,483,502 bp
  • A to C, chromosome 7 at 24,862,380 bp
  • A to G, chromosome 7 at 64,411,917 bp
  • C to T, chromosome 7 at 104,421,456 bp
  • A to G, chromosome 9 at 21,342,185 bp
  • A to G, chromosome 10 at 18,526,739 bp
  • A to G, chromosome 10 at 30,691,729 bp
  • G to A, chromosome 10 at 81,273,807 bp
  • T to A, chromosome 10 at 129,011,897 bp
  • C to A, chromosome 11 at 67,092,370 bp
  • A to G, chromosome 11 at 82,723,824 bp
  • T to C, chromosome 12 at 34,985,141 bp
  • A to G, chromosome 12 at 112,774,648 bp
  • T to C, chromosome 13 at 3,574,388 bp
  • C to T, chromosome 13 at 67,258,126 bp
  • ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC to ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC, chromosome 13 at 117,975,733 bp
  • G to T, chromosome 15 at 83,492,582 bp
  • A to G, chromosome 16 at 4,668,796 bp
  • A to G, chromosome 16 at 16,763,025 bp
  • A to T, chromosome 16 at 18,151,394 bp
  • G to A, chromosome 16 at 26,701,251 bp
  • A to T, chromosome 17 at 21,026,088 bp
  • G to A, chromosome 17 at 24,044,945 bp
  • A to T, chromosome 17 at 25,245,314 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8240 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067671-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.