Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8253Btlr/Mmmh
Stock Number:
067679-MU
Citation ID:
RRID:MMRRC_067679-MU
Other Names:
R8253 (G1)
Major Collection:

Strain Information

Prkar2a
Name: protein kinase, cAMP dependent regulatory, type II alpha
Synonyms: RII(alpha), 1110061A24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19087
HGNC: HGNC:9391
Homologene: 3064
Pdx1
Name: pancreatic and duodenal homeobox 1
Synonyms: IDX-1, STF-1, Ipf1, IPF-1, Mody4, pdx-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18609
HGNC: HGNC:6107
Homologene: 175
Avpr1b
Name: arginine vasopressin receptor 1B
Synonyms: V3/V1b pituitary vasopressin receptor, V3/V1b, V1bR, AVPR3, V1BR, VPR3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26361
HGNC: HGNC:896
Homologene: 22678
Inpp5a
Name: inositol polyphosphate-5-phosphatase A
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212111
HGNC: HGNC:6076
Homologene: 4045
Elf1
Name: E74 like ETS transcription factor 1
Synonyms: Elf-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13709
VEGA: 14
HGNC: HGNC:3316
Homologene: 7303
Uba2
Name: ubiquitin-like modifier activating enzyme 2
Synonyms: Sumo-1 activating enzyme subunit 2, UBA2, anthracycline-associated resistance, Arx, SAE2, Uble1b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50995
Homologene: 4018
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 84,534,877 bp
  • A to T, chromosome 1 at 131,609,416 bp
  • T to C, chromosome 2 at 10,238,595 bp
  • G to T, chromosome 2 at 61,805,241 bp
  • C to A, chromosome 3 at 103,038,721 bp
  • T to C, chromosome 3 at 105,998,367 bp
  • G to A, chromosome 4 at 11,059,086 bp
  • C to T, chromosome 4 at 61,834,574 bp
  • T to A, chromosome 4 at 83,742,970 bp
  • T to C, chromosome 4 at 106,638,520 bp
  • C to T, chromosome 4 at 111,977,478 bp
  • A to T, chromosome 4 at 116,636,643 bp
  • A to G, chromosome 5 at 20,609,307 bp
  • T to C, chromosome 5 at 48,275,671 bp
  • A to G, chromosome 5 at 71,092,070 bp
  • T to C, chromosome 5 at 147,270,649 bp
  • C to T, chromosome 6 at 86,389,062 bp
  • A to G, chromosome 7 at 19,786,232 bp
  • T to G, chromosome 7 at 25,307,514 bp
  • C to T, chromosome 7 at 29,138,862 bp
  • T to C, chromosome 7 at 34,150,898 bp
  • A to T, chromosome 7 at 103,604,331 bp
  • T to A, chromosome 7 at 105,379,087 bp
  • A to G, chromosome 7 at 107,822,569 bp
  • T to C, chromosome 7 at 139,481,640 bp
  • T to A, chromosome 8 at 72,252,886 bp
  • T to C, chromosome 8 at 95,488,377 bp
  • T to A, chromosome 8 at 112,015,008 bp
  • T to A, chromosome 9 at 67,943,488 bp
  • G to T, chromosome 9 at 87,059,055 bp
  • G to T, chromosome 9 at 108,740,439 bp
  • T to C, chromosome 10 at 70,553,203 bp
  • A to T, chromosome 10 at 79,807,677 bp
  • C to T, chromosome 10 at 126,868,674 bp
  • T to C, chromosome 11 at 54,850,401 bp
  • T to A, chromosome 12 at 4,974,159 bp
  • C to T, chromosome 12 at 4,974,160 bp
  • T to G, chromosome 12 at 112,680,312 bp
  • T to A, chromosome 13 at 11,827,553 bp
  • T to A, chromosome 13 at 113,594,781 bp
  • T to C, chromosome 14 at 79,536,352 bp
  • A to G, chromosome 15 at 78,602,737 bp
  • T to A, chromosome 16 at 16,268,542 bp
  • CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT to CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT, chromosome 17 at 30,760,867 bp
  • T to C, chromosome 17 at 55,976,295 bp
  • T to G, chromosome 17 at 73,918,382 bp
  • T to C, chromosome 18 at 61,741,631 bp
  • C to A, chromosome 19 at 38,402,789 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8253 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067679-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.