Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8253Btlr/Mmmh
Stock Number:
067679-MU
Citation ID:
RRID:MMRRC_067679-MU
Other Names:
R8253 (G1)
Major Collection:

Strain Information

Prkar2a
Name: protein kinase, cAMP dependent regulatory, type II alpha
Synonyms: RII(alpha), 1110061A24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19087
HGNC: HGNC:9391
Homologene: 3064
Pdx1
Name: pancreatic and duodenal homeobox 1
Synonyms: IDX-1, STF-1, Ipf1, IPF-1, Mody4, pdx-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18609
HGNC: HGNC:6107
Homologene: 175
Avpr1b
Name: arginine vasopressin receptor 1B
Synonyms: V3/V1b pituitary vasopressin receptor, V3/V1b, V1bR, AVPR3, V1BR, VPR3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26361
HGNC: HGNC:896
Homologene: 22678
Inpp5a
Name: inositol polyphosphate-5-phosphatase A
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212111
HGNC: HGNC:6076
Homologene: 4045
Elf1
Name: E74 like ETS transcription factor 1
Synonyms: Elf-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13709
VEGA: 14
HGNC: HGNC:3316
Homologene: 7303
Uba2
Name: ubiquitin-like modifier activating enzyme 2
Synonyms: Sumo-1 activating enzyme subunit 2, UBA2, anthracycline-associated resistance, Arx, SAE2, Uble1b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50995
Homologene: 4018
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Csnk2a2
Name: casein kinase 2, alpha prime polypeptide
Synonyms: CK2, 1110035J23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13000
HGNC: HGNC:2459
Homologene: 20444
Csde1
Name: cold shock domain containing E1, RNA binding
Synonyms: unr, D3Jfr1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229663
Homologene: 5179
Xdh
Name: xanthine dehydrogenase
Synonyms: Xox-1, Xox1, Xor, xanthine oxidase, XO
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22436
VEGA: 17
Homologene: 324
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Cyb5r4
Name: cytochrome b5 reductase 4
Synonyms: B5+B5R, b5/b5r, 2810034J18Rik, Ncb5or
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 266690
Homologene: 69207
Tbr1
Name: T-box brain transcription factor 1
Synonyms: T-box brain gene 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21375
Homologene: 4807
Slit2
Name: slit guidance ligand 2
Synonyms: Slil3, Drad-1, E130320P19Rik, E030015M03Rik, b2b1200.1Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20563
Homologene: 3516
Fhip1b
Name: FHF complex subunit HOOK interacting protein 1B
Synonyms: 4632419K20Rik, 6530415H11Rik, Fam160a2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74349
Homologene: 75329
Itih5
Name: inter-alpha-trypsin inhibitor, heavy chain 5
Synonyms: 5430408M01Rik, 4631408O11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209378
Homologene: 57115
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Fam13c
Name: family with sequence similarity 13, member C
Synonyms: C030038O19Rik, 1200015N20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71721
Homologene: 11490
Ccdc171
Name: coiled-coil domain containing 171
Synonyms: 4930418J05Rik, A330015D16Rik, 4930473A06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320226
Homologene: 27942
Akr1a1
Name: aldo-keto reductase family 1, member A1
Synonyms: 2610201A18Rik, Akr1a4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 58810
HGNC: HGNC:380
Homologene: 74565
Atad2b
Name: ATPase family, AAA domain containing 2B
Synonyms: 1110014E10Rik, D530031C13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320817
VEGA: 12
Homologene: 86351
Pkp2
Name: plakophilin 2
Synonyms: 1200012P04Rik, 1200008D14Rik, Pkp2l
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67451
HGNC: HGNC:9024
Homologene: 3364
Gabra2
Name: gamma-aminobutyric acid type A receptor subunit alpha 2
Synonyms: Gabra-2, C630048P16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14395
HGNC: HGNC:4076
Homologene: 20217
Afap1l1
Name: actin filament associated protein 1-like 1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106877
Homologene: 18728
Magi2
Name: membrane associated guanylate kinase, WW and PDZ domain containing 2
Synonyms: S-SCAM, Acvrinp1, Magi-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50791
Homologene: 8189
Dner
Name: delta/notch-like EGF repeat containing
Synonyms: BET, A930026D19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227325
Homologene: 26722
Ttc22
Name: tetratricopeptide repeat domain 22
Synonyms: 4732467L16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230576
Homologene: 89253
Tmem145
Name: transmembrane protein 145
Synonyms: B930076A02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330485
Homologene: 18333
Rasgrp4
Name: RAS guanyl releasing protein 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233046
Homologene: 15635
Cimap3
Name: ciliary microtubule associated protein 3
Synonyms: pitchfork, 1700027A23Rik, Pifo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100503311
Homologene: 18759
Mup5
Name: major urinary protein 5
Synonyms: Mup V
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17844
Homologene: 74304
Skint7
Name: selection and upkeep of intraepithelial T cells 7
Synonyms: C130057D23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 328505
Homologene: 106613
Ap1m1
Name: adaptor-related protein complex AP-1, mu subunit 1
Synonyms: AP47, mu1A, [m]1A, Adtm1A, Cltnm
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11767
Homologene: 4017
Or5p50
Name: olfactory receptor family 5 subfamily P member 50
Synonyms: GA_x6K02T2PBJ9-10152980-10152036, MOR204-21, Olfr469
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258418
Homologene: 44979
Cyth4
Name: cytohesin 4
Synonyms: 5830469K17Rik, 2510004M07Rik, Pscd4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72318
VEGA: 15
HGNC: HGNC:9505
Homologene: 22750
Cblc
Name: Casitas B-lineage lymphoma c
Synonyms: Cbl3, 2310079L19Rik, 2310076I21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80794
Homologene: 8108
Ndufaf6
Name: NADH:ubiquinone oxidoreductase complex assembly factor 6
Synonyms: 2310030N02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76947
Homologene: 43831
Zbtb42
Name: zinc finger and BTB domain containing 42
Synonyms: simiRP58, Gm5188
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 382639
Homologene: 20003
Pcyox1
Name: prenylcysteine oxidase 1
Synonyms: 1200015P13Rik, PCL1, Pcly
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66881
Homologene: 9458
Lyrm7
Name: LYR motif containing 7
Synonyms: 9330147L21Rik, 1700024C24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75530
Homologene: 18762
Or52z14
Name: olfactory receptor family 52 subfamily Z member 14
Synonyms: GA_x6K02T2PBJ9-6326488-6327450, MOR31-5, Olfr619
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259080
Homologene: 45095
Slc35g1
Name: solute carrier family 35, member G1
Synonyms: D330039I19Rik, Tmem20
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240660
VEGA: 19
Homologene: 44720
Shd
Name: src homology 2 domain-containing transforming protein D
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20420
VEGA: 17
Homologene: 7537
Gm6793
Name: predicted gene 6793
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 627828
VEGA: 8
Snx18
Name: sorting nexin 18
Synonyms: Snag1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 170625
VEGA: 13
Homologene: 14164
Xrcc6bp1
Name:
Type: Gene
Species: Mouse
Chromosome: 10
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 84,534,877 bp
  • A to T, chromosome 1 at 131,609,416 bp
  • T to C, chromosome 2 at 10,238,595 bp
  • G to T, chromosome 2 at 61,805,241 bp
  • C to A, chromosome 3 at 103,038,721 bp
  • T to C, chromosome 3 at 105,998,367 bp
  • G to A, chromosome 4 at 11,059,086 bp
  • C to T, chromosome 4 at 61,834,574 bp
  • T to A, chromosome 4 at 83,742,970 bp
  • T to C, chromosome 4 at 106,638,520 bp
  • C to T, chromosome 4 at 111,977,478 bp
  • A to T, chromosome 4 at 116,636,643 bp
  • A to G, chromosome 5 at 20,609,307 bp
  • T to C, chromosome 5 at 48,275,671 bp
  • A to G, chromosome 5 at 71,092,070 bp
  • T to C, chromosome 5 at 147,270,649 bp
  • C to T, chromosome 6 at 86,389,062 bp
  • A to G, chromosome 7 at 19,786,232 bp
  • T to G, chromosome 7 at 25,307,514 bp
  • C to T, chromosome 7 at 29,138,862 bp
  • T to C, chromosome 7 at 34,150,898 bp
  • A to T, chromosome 7 at 103,604,331 bp
  • T to A, chromosome 7 at 105,379,087 bp
  • A to G, chromosome 7 at 107,822,569 bp
  • T to C, chromosome 7 at 139,481,640 bp
  • T to A, chromosome 8 at 72,252,886 bp
  • T to C, chromosome 8 at 95,488,377 bp
  • T to A, chromosome 8 at 112,015,008 bp
  • T to A, chromosome 9 at 67,943,488 bp
  • G to T, chromosome 9 at 87,059,055 bp
  • G to T, chromosome 9 at 108,740,439 bp
  • T to C, chromosome 10 at 70,553,203 bp
  • A to T, chromosome 10 at 79,807,677 bp
  • C to T, chromosome 10 at 126,868,674 bp
  • T to C, chromosome 11 at 54,850,401 bp
  • T to A, chromosome 12 at 4,974,159 bp
  • C to T, chromosome 12 at 4,974,160 bp
  • T to G, chromosome 12 at 112,680,312 bp
  • T to A, chromosome 13 at 11,827,553 bp
  • T to A, chromosome 13 at 113,594,781 bp
  • T to C, chromosome 14 at 79,536,352 bp
  • A to G, chromosome 15 at 78,602,737 bp
  • T to A, chromosome 16 at 16,268,542 bp
  • CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT to CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT, chromosome 17 at 30,760,867 bp
  • T to C, chromosome 17 at 55,976,295 bp
  • T to G, chromosome 17 at 73,918,382 bp
  • T to C, chromosome 18 at 61,741,631 bp
  • C to A, chromosome 19 at 38,402,789 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8253 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067679-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.


Title

Text