Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8265Btlr/Mmmh
Stock Number:
067690-MU
Citation ID:
RRID:MMRRC_067690-MU
Other Names:
R8265 (G1)
Major Collection:

Strain Information

Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Tmem59l
Name: transmembrane protein 59-like
Synonyms: 5330410G16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67937
Homologene: 8104
Pipox
Name: pipecolic acid oxidase
Synonyms: Pso
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19193
Homologene: 40640
Ints1
Name: integrator complex subunit 1
Synonyms: 1110015K06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68510
Homologene: 53111
Kdm5a
Name: lysine demethylase 5A
Synonyms: RBP2, Rbbp2, Jarid1a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214899
HGNC: HGNC:9886
Homologene: 3419
Btbd9
Name: BTB domain containing 9
Synonyms: 1700023F20Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224671
VEGA: 17
Homologene: 14995
Eif1
Name: eukaryotic translation initiation factor 1
Synonyms: Sui1-rs1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20918
HGNC: HGNC:3249
Homologene: 135931
Atp2c1
Name: ATPase, Ca++-sequestering
Synonyms: SPCA, ATP2C1A, PMR1, 1700121J11Rik, D930003G21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235574
Homologene: 56672
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100683
Homologene: 39246
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Srsf5
Name: serine and arginine-rich splicing factor 5
Synonyms: Sfrs5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20384
Homologene: 133842
Cit
Name: citron
Synonyms: CRIK-SK, citron-N, citron kinase, Cit-k, C030025P15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12704
HGNC: HGNC:1985
Homologene: 21404
Mei1
Name: meiotic double-stranded break formation protein 1
Synonyms: mei1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74369
Homologene: 46535
Rbm33
Name: RNA binding motif protein 33
Synonyms: 6430512A10Rik, 3200001K10Rik, Prr8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381626
Homologene: 137386
E2f4
Name: E2F transcription factor 4
Synonyms: 2010111M04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104394
HGNC: HGNC:3118
Homologene: 1471
Hnrnpu
Name: heterogeneous nuclear ribonucleoprotein U
Synonyms: scaffold attachment factor A, Sp120, Hnrpu
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 51810
HGNC: HGNC:5048
Homologene: 22991
Pi16
Name: peptidase inhibitor 16
Synonyms: 1200009H11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74116
Homologene: 134317
Plagl1
Name: pleiomorphic adenoma gene-like 1
Synonyms: Zac1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22634
HGNC: HGNC:9046
Homologene: 31401
Myo7a
Name: myosin VIIA
Synonyms: Myo7, USH1B, nmf371, polka, Hdb
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
Prdm14
Name: PR domain containing 14
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 383491
Homologene: 11556
Milr1
Name: mast cell immunoglobulin like receptor 1
Synonyms: LOC380732, Allergin-1, Gm885
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380732
Homologene: 86017
Lama4
Name: laminin, alpha 4
Synonyms: laminin [a]4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16775
HGNC: HGNC:6484
Homologene: 37604
Or8b42
Name: olfactory receptor family 8 subfamily B member 42
Synonyms: GA_x6K02T2PVTD-32123032-32123967, MOR162-8, Olfr901
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258028
VEGA: 9
Homologene: 79399
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: fmd, mdg, Cchl1a3, sj, muscle dysgenesis, Cav1.1, DHPR alpha1s
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Ankrd69
Name: ankyrin repeat domain 69
Synonyms: 4930456F22Rik, 4921537P18Rik, Poteg
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70952
Homologene: 134158
Cped1
Name: cadherin-like and PC-esterase domain containing 1
Synonyms: A430107O13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214642
Homologene: 57014
Rasal3
Name: RAS protein activator like 3
Synonyms: A430107D22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320484
Homologene: 18901
Adam9
Name: ADAM metallopeptidase domain 9
Synonyms: MDC9, Mltng, MDC9, Mltng
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11502
HGNC: HGNC:216
Homologene: 20824
Ceacam20
Name: CEA cell adhesion molecule 20
Synonyms: 9130012D09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71601
Homologene: 19010
Zfp955a
Name: zinc finger protein 955A
Synonyms: AI842447
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 77652
VEGA: 17
Homologene: 104925
Zfp267
Name: zinc finger protein 267
Synonyms: D3Ertd254e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 241944
Homologene: 117700
Sidt1
Name: SID1 transmembrane family, member 1
Synonyms: B830021E24Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 320007
Homologene: 41189
Hmgxb3
Name: HMG box domain containing 3
Synonyms: 2510002C16Rik, A630042L21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106894
VEGA: 18
Homologene: 44229
Cdr1
Name: cerebellar degeneration related antigen 1
Synonyms: Cdr34, Gm7077, Gm2409
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 631990
VEGA: X
HGNC: HGNC:1798
Ddx19b
Name: DEAD box helicase 19b
Synonyms: 4921519L13Rik, 2810457M08Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 19b
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234733
HGNC: HGNC:2742
Homologene: 56032
Or51v14
Name: olfactory receptor family 51 subfamily V member 14
Synonyms: GA_x6K02T2PBJ9-6335095-6334154, MOR4-1, Olfr620
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258808
Homologene: 103777
Taar8a
Name: trace amine-associated receptor 8A
Synonyms: LOC215859
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215859
Homologene: 77586
Rabep2
Name: rabaptin, RAB GTPase binding effector protein 2
Synonyms: 2610011A08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70314
Homologene: 23489
Or51f1e
Name: olfactory receptor family 51 subfamily F member 1E
Synonyms: GA_x6K02T2PBJ9-5809085-5810035, MOR14-4, Olfr585
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259091
Homologene: 133721
1810055G02Rik
Name: RIKEN cDNA 1810055G02 gene
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72056
VEGA: 19
HGNC: HGNC:1174
Homologene: 11174
Pigw
Name: phosphatidylinositol glycan anchor biosynthesis, class W
Synonyms: Gwt1, 2610044A17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70325
Homologene: 6243
Trafd1
Name: TRAF type zinc finger domain containing 1
Synonyms: 1110008K06Rik, Fln29
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231712
Homologene: 31399
Myoz2
Name: myozenin 2
Synonyms: calsarcin-1, 1110012I24Rik, Fatz-2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 59006
HGNC: HGNC:1330
Homologene: 9583
Nt5c1a
Name: 5'-nucleotidase, cytosolic IA
Synonyms: Cn1a, LOC230718
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230718
Homologene: 57173
Sppl2b
Name: signal peptide peptidase like 2B
Synonyms: 3110056O03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73218
VEGA: 10
Homologene: 10605
G530012D18Rik
Name: RIKEN cDNA G530012D1 gene
Type: Gene
Species: Mouse
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 13,114,394 bp
  • A to G, chromosome 1 at 34,178,522 bp
  • C to G, chromosome 1 at 85,577,214 bp
  • G to A, chromosome 1 at 136,092,626 bp
  • A to T, chromosome 1 at 178,332,160 bp
  • T to C, chromosome 3 at 36,159,528 bp
  • A to G, chromosome 3 at 123,006,523 bp
  • T to C, chromosome 4 at 123,214,160 bp
  • T to C, chromosome 5 at 28,394,324 bp
  • C to A, chromosome 5 at 115,988,177 bp
  • T to A, chromosome 5 at 121,373,277 bp
  • C to G, chromosome 5 at 139,772,164 bp
  • C to T, chromosome 5 at 144,785,534 bp
  • A to G, chromosome 6 at 22,222,427 bp
  • T to A, chromosome 6 at 120,406,596 bp
  • G to A, chromosome 7 at 19,974,234 bp
  • A to G, chromosome 7 at 98,085,397 bp
  • A to G, chromosome 7 at 103,098,097 bp
  • A to T, chromosome 7 at 103,611,841 bp
  • A to G, chromosome 7 at 126,444,251 bp
  • T to C, chromosome 8 at 24,967,186 bp
  • T to A, chromosome 8 at 27,494,895 bp
  • A to G, chromosome 8 at 70,485,776 bp
  • T to A, chromosome 8 at 105,301,345 bp
  • A to T, chromosome 8 at 111,009,192 bp
  • T to C, chromosome 9 at 38,431,173 bp
  • C to T, chromosome 9 at 66,386,704 bp
  • T to C, chromosome 9 at 105,470,116 bp
  • C to A, chromosome 10 at 13,128,881 bp
  • T to A, chromosome 10 at 24,076,941 bp
  • G to A, chromosome 10 at 39,105,204 bp
  • TGTCACAGGT to TGT, chromosome 10 at 80,866,069 bp
  • T to A, chromosome 11 at 77,883,967 bp
  • C to A, chromosome 11 at 84,880,021 bp
  • A to G, chromosome 11 at 100,320,473 bp
  • A to G, chromosome 11 at 106,763,885 bp
  • A to G, chromosome 12 at 80,947,336 bp
  • C to A, chromosome 15 at 82,103,307 bp
  • C to A, chromosome 16 at 44,267,887 bp
  • A to G, chromosome 17 at 29,326,973 bp
  • T to A, chromosome 17 at 30,334,304 bp
  • A to G, chromosome 17 at 32,395,820 bp
  • C to T, chromosome 17 at 33,244,113 bp
  • A to G, chromosome 18 at 61,167,338 bp
  • A to G, chromosome 19 at 3,716,568 bp
  • AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC to AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC, chromosome X at 61,184,524 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8265 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067690-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.