Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8265Btlr/Mmmh
Stock Number:
067690-MU
Citation ID:
RRID:MMRRC_067690-MU
Other Names:
R8265 (G1)
Major Collection:

Strain Information

Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Tmem59l
Name: transmembrane protein 59-like
Synonyms: 5330410G16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67937
Homologene: 8104
Pipox
Name: pipecolic acid oxidase
Synonyms: Pso
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19193
Homologene: 40640
Ints1
Name: integrator complex subunit 1
Synonyms: 1110015K06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68510
Homologene: 53111
Kdm5a
Name: lysine demethylase 5A
Synonyms: RBP2, Rbbp2, Jarid1a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214899
HGNC: HGNC:9886
Homologene: 3419
Btbd9
Name: BTB domain containing 9
Synonyms: 1700023F20Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224671
VEGA: 17
Homologene: 14995
Eif1
Name: eukaryotic translation initiation factor 1
Synonyms: Sui1-rs1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20918
HGNC: HGNC:3249
Homologene: 135931
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 13,114,394 bp
  • A to G, chromosome 1 at 34,178,522 bp
  • C to G, chromosome 1 at 85,577,214 bp
  • G to A, chromosome 1 at 136,092,626 bp
  • A to T, chromosome 1 at 178,332,160 bp
  • T to C, chromosome 3 at 36,159,528 bp
  • A to G, chromosome 3 at 123,006,523 bp
  • T to C, chromosome 4 at 123,214,160 bp
  • T to C, chromosome 5 at 28,394,324 bp
  • C to A, chromosome 5 at 115,988,177 bp
  • T to A, chromosome 5 at 121,373,277 bp
  • C to G, chromosome 5 at 139,772,164 bp
  • C to T, chromosome 5 at 144,785,534 bp
  • A to G, chromosome 6 at 22,222,427 bp
  • T to A, chromosome 6 at 120,406,596 bp
  • G to A, chromosome 7 at 19,974,234 bp
  • A to G, chromosome 7 at 98,085,397 bp
  • A to G, chromosome 7 at 103,098,097 bp
  • A to T, chromosome 7 at 103,611,841 bp
  • A to G, chromosome 7 at 126,444,251 bp
  • T to C, chromosome 8 at 24,967,186 bp
  • T to A, chromosome 8 at 27,494,895 bp
  • A to G, chromosome 8 at 70,485,776 bp
  • T to A, chromosome 8 at 105,301,345 bp
  • A to T, chromosome 8 at 111,009,192 bp
  • T to C, chromosome 9 at 38,431,173 bp
  • C to T, chromosome 9 at 66,386,704 bp
  • T to C, chromosome 9 at 105,470,116 bp
  • C to A, chromosome 10 at 13,128,881 bp
  • T to A, chromosome 10 at 24,076,941 bp
  • G to A, chromosome 10 at 39,105,204 bp
  • TGTCACAGGT to TGT, chromosome 10 at 80,866,069 bp
  • T to A, chromosome 11 at 77,883,967 bp
  • C to A, chromosome 11 at 84,880,021 bp
  • A to G, chromosome 11 at 100,320,473 bp
  • A to G, chromosome 11 at 106,763,885 bp
  • A to G, chromosome 12 at 80,947,336 bp
  • C to A, chromosome 15 at 82,103,307 bp
  • C to A, chromosome 16 at 44,267,887 bp
  • A to G, chromosome 17 at 29,326,973 bp
  • T to A, chromosome 17 at 30,334,304 bp
  • A to G, chromosome 17 at 32,395,820 bp
  • C to T, chromosome 17 at 33,244,113 bp
  • A to G, chromosome 18 at 61,167,338 bp
  • A to G, chromosome 19 at 3,716,568 bp
  • AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC to AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC, chromosome X at 61,184,524 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8265 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067690-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.