Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8281Btlr/Mmmh
Stock Number:
067704-MU
Citation ID:
RRID:MMRRC_067704-MU
Other Names:
R8281 (G1)
Major Collection:

Strain Information

Atp1a1
Name: ATPase, Na+/K+ transporting, alpha 1 polypeptide
Synonyms: Atpa-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11928
HGNC: HGNC:799
Homologene: 564
Epb41l4a
Name: erythrocyte membrane protein band 4.1 like 4a
Synonyms: NBL4, Epb4.1l4a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13824
VEGA: 18
Homologene: 8398
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Tmem63b
Name: transmembrane protein 63b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224807
Homologene: 101682
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, AD013, A330063D19Rik, 9030205D12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Lta4h
Name: leukotriene A4 hydrolase
Synonyms: LTA4 hydrodase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16993
VEGA: 10
HGNC: HGNC:6710
Homologene: 6820
Asxl1
Name: ASXL transcriptional regulator 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228790
Homologene: 9098
F2rl1
Name: F2R like trypsin receptor 1
Synonyms: PAR-2, Par2, Protease-activated receptor-2, Gpcr11, proteinase-activated receptor-2, coagulation factor II (thrombin) receptor-like 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14063
VEGA: 13
HGNC: HGNC:3538
Homologene: 21087
Cic
Name: capicua transcriptional repressor
Synonyms: 1200010B10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71722
Homologene: 87637
Fam193a
Name: family with sequence homology 193, member A
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231128
Homologene: 2746
D5Ertd579e
Name: DNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms: 9030221A05Rik, A930018H20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320661
Homologene: 19716
Adgrf3
Name: adhesion G protein-coupled receptor F3
Synonyms: LOC381628, PGR23, Gpr113
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381628
Homologene: 17826
Slc12a7
Name: solute carrier family 12, member 7
Synonyms: Kcc4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20499
VEGA: 13
Homologene: 21312
Marchf7
Name: membrane associated ring-CH-type finger 7
Synonyms: Axot, Gtrgeo17, March7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 57438
Homologene: 10753
Kalrn
Name: kalirin, RhoGEF kinase
Synonyms: LOC224126, Hapip, 2210407G14Rik, E530005C20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 545156
HGNC: HGNC:4814
Homologene: 57160
Rbp3
Name: retinol binding protein 3, interstitial
Synonyms: Irbp, Rbp-3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19661
VEGA: 14
HGNC: HGNC:9921
Homologene: 9261
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Tomm20l
Name: translocase of outer mitochondrial membrane 20-like
Synonyms: 4930553D19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75266
VEGA: 12
Homologene: 52617
Ern2
Name: endoplasmic reticulum to nucleus signalling 2
Synonyms: Ire1b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26918
Homologene: 22687
Stab2
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192188
Homologene: 23022
Drc7
Name: dynein regulatory complex subunit 7
Synonyms: LOC330830, SRG-L, Ccdc135
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330830
Homologene: 12996
Spaca6
Name: sperm acrosome associated 6
Synonyms: B230206P06Rik, 4930546H06Rik, Ncrna00085
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75202
Homologene: 53443
Rp1
Name: retinitis pigmentosa 1 (human)
Synonyms: oxygen-regulated protein 1, Orp1, mG145, Dcdc3, Rp1h
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19888
Homologene: 4564
Ccdc168
Name: coiled-coil domain containing 168
Synonyms: Gm8251
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 102636082
VEGA: 1
Homologene: 141149
Pcdh8
Name: protocadherin 8
Synonyms: Papc, 1700080P15Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18530
HGNC: HGNC:8660
Homologene: 1943
Plch2
Name: phospholipase C, eta 2
Synonyms: PLCeta2, A930027K05Rik, Plcl4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269615
Homologene: 85172
Axl
Name: AXL receptor tyrosine kinase
Synonyms: Tyro7, Ark, Ufo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26362
HGNC: HGNC:905
Homologene: 7583
F13b
Name: coagulation factor XIII, beta subunit
Synonyms: Cf-13b, Cf13b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14060
HGNC: HGNC:3534
Homologene: 1512
Adam7
Name: a disintegrin and metallopeptidase domain 7
Synonyms: EAP1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11500
HGNC: HGNC:214
Homologene: 2830
Vill
Name: villin-like
Synonyms: Villp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22351
Homologene: 22650
Spata31e5
Name: spermatogenesis associated 31 subfamily E member 5
Synonyms: LOC210962, Gm597
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210962
Pbld2
Name: phenazine biosynthesis-like protein domain containing 2
Synonyms: 3110049J23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67307
Cyp3a13
Name: cytochrome P450, family 3, subfamily a, polypeptide 13
Synonyms: IIIAm2, steroid inducible
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13113
Homologene: 133564
Iqca1l
Name: IQ motif containing with AAA domain 1 like
Synonyms: 4931409K22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231045
Homologene: 18602
Trav13-5
Name: T cell receptor alpha variable 13-5
Synonyms: B230359F08Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219060
Dip2a
Name: disco interacting protein 2 homolog A
Synonyms: Kiaa0184-hp, 4931420H10Rik, Dip2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64451
Homologene: 41012
Msl2
Name: MSL complex subunit 2
Synonyms: E130103E02Rik, Rnf184, Msl2l1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77853
Homologene: 10021
Gm10110
Name: predicted gene 10110
Type: Gene
Species: Mouse
Chromosome: 14
Klk1b16
Name: kallikrein 1-related peptidase b16
Synonyms: mGk-16, Klk16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16615
Homologene: 68141
Rasl2-9
Name: RAS-like, family 2, locus 9
Synonyms: Ran/M2, Rasl2-9-ps
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19428
Homologene: 135303
Otop3
Name: otopetrin 3
Synonyms: 2310011E08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69602
Homologene: 26091
Thpo
Name: thrombopoietin
Synonyms: TPO-4, TPO-3, TPO-2, TPO-1, TPO, Mpllg, myeloproliferative leukemia virus oncogene ligand
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21832
Homologene: 398
Mob3c
Name: MOB kinase activator 3C
Synonyms: MOB3C, D130076I06Rik, Mobkl2c
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100465
Homologene: 64826
Speer1h
Name: spermatogenesis associated glutamate (E)-rich protein 1H
Synonyms: Gm6460
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 623898
Homologene: 69402
Gm8232
Name: predicted gene 8232
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 666678
Homologene: 128452
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 4,347,916 bp
  • C to T, chromosome 1 at 28,778,144 bp
  • T to G, chromosome 1 at 44,056,538 bp
  • G to T, chromosome 1 at 139,510,951 bp
  • C to T, chromosome 2 at 60,234,529 bp
  • A to G, chromosome 2 at 153,399,401 bp
  • A to G, chromosome 3 at 101,579,624 bp
  • T to C, chromosome 4 at 115,831,438 bp
  • T to A, chromosome 4 at 155,006,973 bp
  • T to A, chromosome 5 at 11,597,679 bp
  • T to A, chromosome 5 at 24,549,010 bp
  • T to C, chromosome 5 at 30,197,303 bp
  • C to A, chromosome 5 at 34,443,436 bp
  • A to T, chromosome 5 at 36,613,320 bp
  • G to C, chromosome 5 at 137,894,297 bp
  • CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC to CATC, chromosome 6 at 4,756,431 bp
  • A to T, chromosome 7 at 5,125,352 bp
  • G to A, chromosome 7 at 25,271,824 bp
  • C to T, chromosome 7 at 25,763,954 bp
  • A to G, chromosome 7 at 44,141,547 bp
  • T to A, chromosome 7 at 120,202,027 bp
  • T to C, chromosome 7 at 122,170,260 bp
  • A to G, chromosome 8 at 91,036,597 bp
  • G to A, chromosome 8 at 95,062,177 bp
  • T to C, chromosome 9 at 101,101,695 bp
  • T to C, chromosome 9 at 119,058,479 bp
  • T to G, chromosome 10 at 63,048,026 bp
  • T to C, chromosome 10 at 76,276,604 bp
  • A to T, chromosome 10 at 86,873,864 bp
  • G to T, chromosome 10 at 93,453,594 bp
  • T to C, chromosome 11 at 115,345,075 bp
  • T to C, chromosome 12 at 71,111,467 bp
  • G to A, chromosome 13 at 73,790,677 bp
  • A to G, chromosome 13 at 95,514,077 bp
  • A to G, chromosome 13 at 114,455,241 bp
  • A to G, chromosome 14 at 33,956,363 bp
  • A to G, chromosome 14 at 44,437,091 bp
  • A to G, chromosome 14 at 53,795,461 bp
  • G to A, chromosome 14 at 68,507,885 bp
  • A to G, chromosome 14 at 79,769,479 bp
  • C to T, chromosome 14 at 89,898,241 bp
  • T to C, chromosome 16 at 15,705,253 bp
  • T to C, chromosome 16 at 20,725,775 bp
  • C to T, chromosome 16 at 34,035,061 bp
  • A to G, chromosome 17 at 17,832,059 bp
  • T to A, chromosome 17 at 45,660,796 bp
  • T to C, chromosome 18 at 33,878,945 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8281 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067704-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.