Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8295Btlr/Mmmh
Stock Number:
067714-MU
Citation ID:
RRID:MMRRC_067714-MU
Other Names:
R8295 (G1)
Major Collection:

Strain Information

Tnrc6b
Name: trinucleotide repeat containing 6b
Synonyms: A730065C02Rik, D230019K20Rik, 2700090M07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 213988
VEGA: 15
Homologene: 66194
Ahdc1
Name: AT hook, DNA binding motif, containing 1
Synonyms: D030015G18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230793
Homologene: 17144
Gtf3c1
Name: general transcription factor III C 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233863
HGNC: HGNC:4664
Homologene: 31040
Fndc3a
Name: fibronectin type III domain containing 3A
Synonyms: 1700094E19Rik, F730017H24Rik, D14Ertd453e, Fndc3, sys
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 319448
Homologene: 8952
Epha8
Name: Eph receptor A8
Synonyms: EphA8, Hek3, Eek
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13842
HGNC: HGNC:3391
Homologene: 22436
Eif2d
Name: eukaryotic translation initiation factor 2D
Synonyms: D1Ertd5e, Lgtn
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16865
HGNC: HGNC:6583
Homologene: 38244
Dlx1
Name: distal-less homeobox 1
Synonyms: DII B, Dlx, Dlx-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13390
HGNC: HGNC:2914
Homologene: 22558
Card6
Name: caspase recruitment domain family, member 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239319
Homologene: 13067
Abcf2
Name: ATP-binding cassette, sub-family F member 2
Synonyms: 0710005O05Rik, Drr3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27407
Homologene: 21408
Ints2
Name: integrator complex subunit 2
Synonyms: 2810417D08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70422
Homologene: 10801
Dock8
Name: dedicator of cytokinesis 8
Synonyms: 1200017A24Rik, 5830472H07Rik, A130095G14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76088
VEGA: 19
Homologene: 52414
Ltbp1
Name: latent transforming growth factor beta binding protein 1
Synonyms: LTBP-1, 9430031G15Rik, b2b1000Clo, Ltbp1L
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268977
HGNC: HGNC:6714
Homologene: 522
C7
Name: complement component 7
Synonyms: LOC383055
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 109828
VEGA: 15
HGNC: HGNC:1346
Homologene: 489
Abca15
Name: ATP-binding cassette, sub-family A member 15
Synonyms: 4930500I12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320631
Homologene: 87255
Kcnh4
Name: potassium voltage-gated channel, subfamily H (eag-related), member 4
Synonyms: BEC2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380728
HGNC: HGNC:6253
Homologene: 8180
S100a16
Name: S100 calcium binding protein A16
Synonyms: 2300002L21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67860
Homologene: 12201
Ccdc110
Name: coiled-coil domain containing 110
Synonyms: LOC212392
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212392
Homologene: 17668
4932411E22Rik
Name: RIKEN cDNA 4932411E22 gene
Type: Gene
Species: Mouse
Chromosome: 11
Zfp595
Name: zinc finger protein 595
Synonyms: A230042K10Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218314
Homologene: 120258
Vmn2r18
Name: vomeronasal 2, receptor 18
Synonyms: EG632671
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 632671
Vmn2r90
Name: vomeronasal 2, receptor 90
Synonyms: EG626942
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 626942
Tmem168
Name: transmembrane protein 168
Synonyms: 5730526F17Rik, 8430437G11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101118
Homologene: 11202
Sprr1a
Name: small proline-rich protein 1A
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20753
Homologene: 105698
Pih1d2
Name: PIH1 domain containing 2
Synonyms: 2700059L22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72614
Homologene: 12474
H2-Ab1
Name: histocompatibility 2, class II antigen A, beta 1
Synonyms: A beta, Abeta, H-2Ab, Ia-2, Ia2, H2-Ab, IAb, I-Ab, I-Abeta, Rmcs1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14961
Homologene: 1603
Or52ab4
Name: olfactory receptor family 52 subfamily AB member 4
Synonyms: GA_x6K02T2PBJ9-6047402-6048349, MOR23-1, Olfr599
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258726
Homologene: 27244
Vmn1r234
Name: vomeronasal 1 receptor 234
Synonyms: V1rf1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171232
Or8k17
Name: olfactory receptor family 8 subfamily K member 17
Synonyms: GA_x6K02T2Q125-47716657-47715716, MOR187-2, Olfr1048
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259016
Akr1c12
Name: aldo-keto reductase family 1, member C12
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 622402
Homologene: 121208
Obox2
Name: oocyte specific homeobox 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 246792
Homologene: 44937
Pou2af1
Name: POU domain, class 2, associating factor 1
Synonyms: OBF.1, BOB.1, OBF-1, Bob1, OCA-B, OCAB, Bob-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18985
VEGA: 9
HGNC: HGNC:9211
Homologene: 4543
Rnase2a
Name: ribonuclease, RNase A family, 2A (liver, eosinophil-derived neurotoxin)
Synonyms: Ear11
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 93726
VEGA: 14
Homologene: 121614
Trav21-dv12
Name: T cell receptor alpha variable 21-DV12
Synonyms: Gm13892
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100101940
Gm21886
Name: predicted gene, 21886
Type: Gene
Species: Mouse
Chromosome: 18
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 131,158,251 bp
  • C to A, chromosome 2 at 71,532,382 bp
  • T to C, chromosome 2 at 86,236,572 bp
  • G to T, chromosome 3 at 89,173,459 bp
  • T to A, chromosome 3 at 90,542,029 bp
  • T to C, chromosome 3 at 92,484,542 bp
  • T to A, chromosome 4 at 133,061,451 bp
  • G to T, chromosome 4 at 136,938,586 bp
  • CAT to CATAAT, chromosome 5 at 24,576,591 bp
  • A to G, chromosome 5 at 151,585,156 bp
  • A to T, chromosome 6 at 13,602,851 bp
  • A to G, chromosome 7 at 15,397,322 bp
  • C to T, chromosome 7 at 103,338,267 bp
  • T to G, chromosome 7 at 120,374,965 bp
  • A to G, chromosome 7 at 125,663,062 bp
  • A to G, chromosome 8 at 45,943,379 bp
  • C to T, chromosome 9 at 50,621,079 bp
  • C to T, chromosome 9 at 51,233,005 bp
  • T to C, chromosome 11 at 86,225,088 bp
  • C to T, chromosome 11 at 89,412,097 bp
  • A to G, chromosome 11 at 100,749,697 bp
  • T to G, chromosome 13 at 4,272,356 bp
  • A to G, chromosome 13 at 67,316,700 bp
  • T to A, chromosome 14 at 51,255,639 bp
  • T to A, chromosome 14 at 53,876,053 bp
  • T to C, chromosome 14 at 72,552,519 bp
  • A to T, chromosome 15 at 4,988,845 bp
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp
  • T to C, chromosome 15 at 80,913,364 bp
  • C to T, chromosome 17 at 17,728,096 bp
  • T to A, chromosome 17 at 21,228,839 bp
  • A to T, chromosome 17 at 34,264,842 bp
  • A to T, chromosome 17 at 75,179,189 bp
  • ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG to ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG, chromosome 18 at 80,089,825 bp
  • G to A, chromosome 19 at 25,123,236 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8295 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067714-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.