Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8326Btlr/Mmmh
Stock Number:
067726-MU
Citation ID:
RRID:MMRRC_067726-MU
Other Names:
R8326 (G1)
Major Collection:

Strain Information

Tyrp1
Name: tyrosinase-related protein 1
Synonyms: Tyrp, isa, TRP-1, TRP1, Oca3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22178
Homologene: 464
Myo5a
Name: myosin VA
Synonyms: MVa, MyoVA, Myo5, flail, 9630007J19Rik, Dbv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Gse1
Name: genetic suppressor element 1, coiled-coil protein
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382034
Homologene: 40964
Adgrl2
Name: adhesion G protein-coupled receptor L2
Synonyms: Lphh1, Lec1, Lphn2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99633
Homologene: 22712
Heatr5a
Name: HEAT repeat containing 5A
Synonyms: D930036F22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320487
VEGA: 12
Homologene: 19635
Parn
Name: poly(A)-specific ribonuclease (deadenylation nuclease)
Synonyms: DAN, 1200003I18Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74108
VEGA: 16
HGNC: HGNC:8609
Homologene: 31098
Dcp1a
Name: decapping mRNA 1A
Synonyms: 1110066A22Rik, SMIF, 4930568L04Rik, D14Ertd817e, Mitc1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 75901
VEGA: 14
Homologene: 10178
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 36,376,760 bp
  • A to T, chromosome 1 at 58,295,887 bp
  • G to A, chromosome 1 at 75,218,621 bp
  • A to T, chromosome 1 at 80,606,175 bp
  • A to T, chromosome 1 at 84,912,345 bp
  • T to C, chromosome 1 at 177,050,045 bp
  • C to T, chromosome 2 at 13,306,463 bp
  • T to C, chromosome 2 at 52,221,702 bp
  • G to T, chromosome 3 at 59,194,974 bp
  • T to A, chromosome 3 at 103,311,454 bp
  • T to C, chromosome 3 at 148,827,554 bp
  • A to G, chromosome 4 at 21,679,557 bp
  • G to T, chromosome 4 at 58,847,093 bp
  • G to A, chromosome 4 at 80,850,684 bp
  • T to C, chromosome 4 at 105,036,298 bp
  • T to C, chromosome 5 at 125,787,554 bp
  • A to G, chromosome 6 at 90,203,264 bp
  • C to T, chromosome 7 at 6,233,947 bp
  • A to G, chromosome 7 at 10,718,544 bp
  • T to C, chromosome 7 at 15,833,556 bp
  • A to T, chromosome 7 at 43,726,712 bp
  • T to C, chromosome 7 at 45,409,341 bp
  • G to T, chromosome 7 at 66,659,927 bp
  • A to G, chromosome 7 at 103,937,602 bp
  • G to A, chromosome 7 at 114,553,170 bp
  • T to C, chromosome 8 at 94,639,589 bp
  • T to C, chromosome 8 at 120,578,580 bp
  • A to G, chromosome 9 at 7,147,771 bp
  • T to C, chromosome 9 at 38,026,718 bp
  • A to T, chromosome 9 at 59,519,217 bp
  • T to C, chromosome 9 at 75,217,989 bp
  • A to G, chromosome 9 at 111,467,534 bp
  • T to C, chromosome 10 at 24,049,913 bp
  • A to T, chromosome 10 at 60,126,955 bp
  • T to C, chromosome 10 at 60,438,812 bp
  • G to T, chromosome 10 at 76,217,413 bp
  • A to T, chromosome 10 at 130,472,311 bp
  • A to G, chromosome 11 at 66,117,626 bp
  • G to T, chromosome 11 at 100,381,745 bp
  • AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA to AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA, chromosome 12 at 51,887,919 bp
  • A to T, chromosome 13 at 38,191,635 bp
  • C to T, chromosome 13 at 81,445,343 bp
  • C to T, chromosome 14 at 30,519,570 bp
  • C to A, chromosome 14 at 33,511,035 bp
  • T to C, chromosome 14 at 45,294,348 bp
  • T to A, chromosome 14 at 55,605,753 bp
  • A to G, chromosome 15 at 89,280,447 bp
  • A to T, chromosome 16 at 13,665,971 bp
  • A to T, chromosome 16 at 90,988,196 bp
  • T to G, chromosome 17 at 37,530,579 bp
  • C to A, chromosome 17 at 45,559,308 bp
  • T to C, chromosome 17 at 81,408,106 bp
  • C to T, chromosome 17 at 87,986,912 bp
  • A to G, chromosome 18 at 20,449,731 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8326 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067726-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.