Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8326Btlr/Mmmh
Stock Number:
067726-MU
Citation ID:
RRID:MMRRC_067726-MU
Other Names:
R8326 (G1)
Major Collection:

Strain Information

Tyrp1
Name: tyrosinase-related protein 1
Synonyms: Tyrp, isa, TRP-1, TRP1, Oca3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22178
Homologene: 464
Myo5a
Name: myosin VA
Synonyms: MVa, MyoVA, Myo5, flail, 9630007J19Rik, Dbv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Gse1
Name: genetic suppressor element 1, coiled-coil protein
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382034
Homologene: 40964
Adgrl2
Name: adhesion G protein-coupled receptor L2
Synonyms: Lphh1, Lec1, Lphn2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99633
Homologene: 22712
Heatr5a
Name: HEAT repeat containing 5A
Synonyms: D930036F22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320487
VEGA: 12
Homologene: 19635
Parn
Name: poly(A)-specific ribonuclease (deadenylation nuclease)
Synonyms: DAN, 1200003I18Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74108
VEGA: 16
HGNC: HGNC:8609
Homologene: 31098
Dcp1a
Name: decapping mRNA 1A
Synonyms: 1110066A22Rik, SMIF, 4930568L04Rik, D14Ertd817e, Mitc1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 75901
VEGA: 14
Homologene: 10178
Rspry1
Name: ring finger and SPRY domain containing 1
Synonyms: 4930470D19Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67610
Homologene: 12164
Ecpas
Name: Ecm29 proteasome adaptor and scaffold
Synonyms: AI314180
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230249
Homologene: 6056
Dsp
Name: desmoplakin
Synonyms: 2300002E22Rik, DP, 5730453H04Rik, rul
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Prmt2
Name: protein arginine N-methyltransferase 2
Synonyms: Hrmt1l1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15468
HGNC: HGNC:5186
Homologene: 55587
Dsg4
Name: desmoglein 4
Synonyms: lah, CDHF13
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16769
Homologene: 65341
Msh6
Name: mutS homolog 6
Synonyms: Msh6, GTBP, Gtmbp
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17688
VEGA: 17
HGNC: HGNC:7329
Homologene: 149
Jup
Name: junction plakoglobin
Synonyms: PG, plakoglobin, gamma-catenin, D930025P04Rik, Ctnng
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16480
HGNC: HGNC:6207
Homologene: 1680
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Ero1a
Name: endoplasmic reticulum oxidoreductase 1 alpha
Synonyms: Ero1l
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50527
VEGA: 14
Homologene: 49392
Trim33
Name: tripartite motif-containing 33
Synonyms: Tif1g, 8030451N04Rik, ectodermin, Ecto
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 94093
Homologene: 9296
Dclk3
Name: doublecortin-like kinase 3
Synonyms: Click-I, -II related, Dcamkl3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245038
Homologene: 70580
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, nmf112, nmf181, nmf252, bob, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Cyp2r1
Name: cytochrome P450, family 2, subfamily r, polypeptide 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244209
Homologene: 75210
Cubn
Name: cubilin
Synonyms: D2Wsu88e, intrinsic factor-cobalamin receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Prkaa2
Name: protein kinase, AMP-activated, alpha 2 catalytic subunit
Synonyms: 2310008I11Rik, AMPKalpha2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 108079
HGNC: HGNC:9377
Homologene: 4551
Tmem202
Name: transmembrane protein 202
Synonyms: 4930425N13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73893
VEGA: 9
Homologene: 52264
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Dock10
Name: dedicator of cytokinesis 10
Synonyms: Jr5, Jr4, ZIZ3, 9330153B10Rik, A630054M16Rik, Zizimin3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210293
Homologene: 45952
Ppp6r2
Name: protein phosphatase 6, regulatory subunit 2
Synonyms: 1110033O10Rik, 8430411H09Rik, B230107H12Rik, Pp6r2, Saps2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71474
VEGA: 15
Homologene: 36455
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Aox2
Name: aldehyde oxidase 2
Synonyms: Aox3l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213043
Homologene: 84622
Nlrp4b
Name: NLR family, pyrin domain containing 4B
Synonyms: Nalp-gamma, Nalp4b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210045
Homologene: 65242
Slc8a1
Name: solute carrier family 8 (sodium/calcium exchanger), member 1
Synonyms: Ncx1, D930008O12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20541
VEGA: 17
Homologene: 69090
Obox6
Name: oocyte specific homeobox 6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 252830
Or51ai2
Name: olfactory receptor family 51 subfamily AI member 2
Synonyms: GA_x6K02T2PBJ9-6671256-6672209, MOR2-1, Olfr632
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259123
Homologene: 64963
Taar7f
Name: trace amine-associated receptor 7F
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 435207
Homologene: 134040
Gpr87
Name: G protein-coupled receptor 87
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 84111
HGNC: HGNC:4538
Homologene: 13021
Akt3
Name: thymoma viral proto-oncogene 3
Synonyms: PKB gamma, D930002M15Rik, Nmf350
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23797
HGNC: HGNC:393
Homologene: 55904
Synj1
Name: synaptojanin 1
Synonyms: A930006D20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 104015
Homologene: 48252
Irf9
Name: interferon regulatory factor 9
Synonyms: p48, Irf-9, Isgf3g
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16391
HGNC: HGNC:6131
Homologene: 4436
Klk13
Name: kallikrein related-peptidase 13
Synonyms: mGk-13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 626834
HGNC: HGNC:6361
Homologene: 56714
Slc16a14
Name: solute carrier family 16 (monocarboxylic acid transporters), member 14
Synonyms: 1110004H10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71781
Homologene: 34318
Or5v1b
Name: olfactory receptor family 5 subfamily V member 1B
Synonyms: GA_x6K02T2PSCP-1989071-1990024, MOR249-1P, Olfr111
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 545205
Homologene: 73968
Vmn2r87
Name: vomeronasal 2, receptor 87
Synonyms: EG625131
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625131
Homologene: 129606
Prdm13
Name: PR domain containing 13
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230025
Homologene: 11000
V1ra8
Name: vomeronasal 1 receptor, A8
Synonyms: Vmn1r-ps33
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113850
Kcna7
Name: potassium voltage-gated channel, shaker-related subfamily, member 7
Synonyms: Kv1.7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16495
HGNC: HGNC:6226
Homologene: 7791
Tuba4a
Name: tubulin, alpha 4A
Synonyms: M[a]4, Tuba4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22145
Homologene: 68496
Tmem132b
Name: transmembrane protein 132B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208151
Homologene: 28135
Asb7
Name: ankyrin repeat and SOCS box-containing 7
Synonyms: Asb-7, D030055C23Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 117589
Homologene: 34130
Zscan5b
Name: zinc finger and SCAN domain containing 5B
Synonyms: Zfg1, Zfp371
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 170734
Homologene: 129555
Or8b36
Name: olfactory receptor family 8 subfamily B member 36
Synonyms: GA_x6K02T2PVTD-31705144-31706073, MOR162-6, Olfr883
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258414
Homologene: 86689
Nfkbie
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, epsilon
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18037
VEGA: 17
HGNC: HGNC:7799
Homologene: 36160
Spock2
Name: sparc/osteonectin, cwcv and kazal-like domains proteoglycan 2
Synonyms: testican-2, Gcap26
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 94214
Homologene: 8854
Fer1l5
Name: fer-1 like family member 5
Synonyms: 4930533C12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100534273
Homologene: 85232
Frmpd2
Name: FERM and PDZ domain containing 2
Synonyms: LOC380890, LOC268729, Frmpd2, ENSMUSG00000071536, Gm626
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268729
Homologene: 51854
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 36,376,760 bp
  • A to T, chromosome 1 at 58,295,887 bp
  • G to A, chromosome 1 at 75,218,621 bp
  • A to T, chromosome 1 at 80,606,175 bp
  • A to T, chromosome 1 at 84,912,345 bp
  • T to C, chromosome 1 at 177,050,045 bp
  • C to T, chromosome 2 at 13,306,463 bp
  • T to C, chromosome 2 at 52,221,702 bp
  • G to T, chromosome 3 at 59,194,974 bp
  • T to A, chromosome 3 at 103,311,454 bp
  • T to C, chromosome 3 at 148,827,554 bp
  • A to G, chromosome 4 at 21,679,557 bp
  • G to T, chromosome 4 at 58,847,093 bp
  • G to A, chromosome 4 at 80,850,684 bp
  • T to C, chromosome 4 at 105,036,298 bp
  • T to C, chromosome 5 at 125,787,554 bp
  • A to G, chromosome 6 at 90,203,264 bp
  • C to T, chromosome 7 at 6,233,947 bp
  • A to G, chromosome 7 at 10,718,544 bp
  • T to C, chromosome 7 at 15,833,556 bp
  • A to T, chromosome 7 at 43,726,712 bp
  • T to C, chromosome 7 at 45,409,341 bp
  • G to T, chromosome 7 at 66,659,927 bp
  • A to G, chromosome 7 at 103,937,602 bp
  • G to A, chromosome 7 at 114,553,170 bp
  • T to C, chromosome 8 at 94,639,589 bp
  • T to C, chromosome 8 at 120,578,580 bp
  • A to G, chromosome 9 at 7,147,771 bp
  • T to C, chromosome 9 at 38,026,718 bp
  • A to T, chromosome 9 at 59,519,217 bp
  • T to C, chromosome 9 at 75,217,989 bp
  • A to G, chromosome 9 at 111,467,534 bp
  • T to C, chromosome 10 at 24,049,913 bp
  • A to T, chromosome 10 at 60,126,955 bp
  • T to C, chromosome 10 at 60,438,812 bp
  • G to T, chromosome 10 at 76,217,413 bp
  • A to T, chromosome 10 at 130,472,311 bp
  • A to G, chromosome 11 at 66,117,626 bp
  • G to T, chromosome 11 at 100,381,745 bp
  • AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA to AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA, chromosome 12 at 51,887,919 bp
  • A to T, chromosome 13 at 38,191,635 bp
  • C to T, chromosome 13 at 81,445,343 bp
  • C to T, chromosome 14 at 30,519,570 bp
  • C to A, chromosome 14 at 33,511,035 bp
  • T to C, chromosome 14 at 45,294,348 bp
  • T to A, chromosome 14 at 55,605,753 bp
  • A to G, chromosome 15 at 89,280,447 bp
  • A to T, chromosome 16 at 13,665,971 bp
  • A to T, chromosome 16 at 90,988,196 bp
  • T to G, chromosome 17 at 37,530,579 bp
  • C to A, chromosome 17 at 45,559,308 bp
  • T to C, chromosome 17 at 81,408,106 bp
  • C to T, chromosome 17 at 87,986,912 bp
  • A to G, chromosome 18 at 20,449,731 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8326 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067726-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.