Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8338Btlr/Mmmh
Stock Number:
067730-MU
Citation ID:
RRID:MMRRC_067730-MU
Other Names:
R8338 (G1)
Major Collection:

Strain Information

Strap
Name: serine/threonine kinase receptor associated protein
Synonyms: C78091, Unrip
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20901
Homologene: 43881
Wsb1
Name: WD repeat and SOCS box-containing 1
Synonyms: 2700038M07Rik, 1110056B13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78889
Homologene: 9218
Lcat
Name: lecithin cholesterol acyltransferase
Synonyms: D8Wsu61e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16816
HGNC: HGNC:6522
Homologene: 68042
Chd1
Name: chromodomain helicase DNA binding protein 1
Synonyms: 4930525N21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12648
HGNC: HGNC:1915
Homologene: 68174
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Mib1
Name: MIB E3 ubiquitin protein ligase 1
Synonyms: E430019M12Rik, Mib, skeletrophin, mind bomb-1, mindbomb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225164
Homologene: 10810
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 6,809,292 bp
  • A to G, chromosome 1 at 36,227,521 bp
  • A to C, chromosome 1 at 59,060,575 bp
  • G to A, chromosome 1 at 65,048,774 bp
  • A to G, chromosome 1 at 133,608,943 bp
  • C to A, chromosome 1 at 136,494,678 bp
  • G to A, chromosome 1 at 150,738,734 bp
  • C to T, chromosome 1 at 160,118,483 bp
  • A to T, chromosome 2 at 11,683,074 bp
  • A to C, chromosome 2 at 13,430,847 bp
  • G to T, chromosome 2 at 32,778,006 bp
  • T to G, chromosome 2 at 76,919,792 bp
  • A to T, chromosome 2 at 86,445,385 bp
  • A to T, chromosome 2 at 90,471,137 bp
  • A to G, chromosome 2 at 91,492,368 bp
  • T to G, chromosome 2 at 129,285,019 bp
  • A to T, chromosome 2 at 181,801,862 bp
  • T to C, chromosome 3 at 18,097,566 bp
  • A to G, chromosome 3 at 94,265,978 bp
  • C to T, chromosome 4 at 4,076,620 bp
  • T to A, chromosome 4 at 73,687,198 bp
  • A to C, chromosome 4 at 88,780,127 bp
  • G to A, chromosome 4 at 156,168,561 bp
  • T to A, chromosome 4 at 156,199,631 bp
  • A to G, chromosome 5 at 124,832,502 bp
  • T to C, chromosome 5 at 137,291,744 bp
  • C to T, chromosome 5 at 150,359,051 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • T to A, chromosome 6 at 30,140,248 bp
  • T to C, chromosome 6 at 40,571,976 bp
  • A to T, chromosome 6 at 54,943,971 bp
  • G to A, chromosome 6 at 68,571,175 bp
  • A to T, chromosome 6 at 101,150,822 bp
  • G to T, chromosome 6 at 106,712,389 bp
  • A to T, chromosome 6 at 137,741,978 bp
  • G to A, chromosome 6 at 149,513,123 bp
  • A to T, chromosome 7 at 24,003,249 bp
  • A to T, chromosome 7 at 80,320,870 bp
  • T to C, chromosome 7 at 86,412,494 bp
  • T to C, chromosome 7 at 120,071,881 bp
  • T to A, chromosome 7 at 140,345,393 bp
  • A to G, chromosome 8 at 70,331,122 bp
  • G to A, chromosome 8 at 105,940,087 bp
  • A to G, chromosome 9 at 44,684,511 bp
  • C to T, chromosome 9 at 108,827,340 bp
  • T to A, chromosome 10 at 51,718,094 bp
  • T to A, chromosome 10 at 53,925,547 bp
  • T to A, chromosome 10 at 56,028,077 bp
  • T to C, chromosome 11 at 12,253,696 bp
  • G to C, chromosome 11 at 24,164,578 bp
  • A to G, chromosome 11 at 53,463,280 bp
  • C to A, chromosome 11 at 65,841,241 bp
  • C to T, chromosome 11 at 69,487,296 bp
  • T to C, chromosome 11 at 79,246,277 bp
  • T to C, chromosome 11 at 80,821,309 bp
  • T to A, chromosome 11 at 102,438,346 bp
  • G to A, chromosome 12 at 81,504,552 bp
  • T to C, chromosome 14 at 47,268,663 bp
  • T to A, chromosome 14 at 103,135,265 bp
  • C to A, chromosome 15 at 99,101,141 bp
  • T to A, chromosome 15 at 99,178,459 bp
  • G to T, chromosome 16 at 27,324,535 bp
  • G to T, chromosome 16 at 37,174,356 bp
  • G to A, chromosome 16 at 44,419,335 bp
  • A to T, chromosome 16 at 91,036,547 bp
  • A to G, chromosome 17 at 15,769,980 bp
  • A to T, chromosome 17 at 27,435,003 bp
  • A to G, chromosome 17 at 27,876,695 bp
  • A to T, chromosome 17 at 33,136,413 bp
  • T to C, chromosome 17 at 63,356,758 bp
  • A to G, chromosome 18 at 10,726,372 bp
  • A to G, chromosome 18 at 31,971,355 bp
  • G to T, chromosome 18 at 37,449,122 bp
  • A to G, chromosome 18 at 37,973,630 bp
  • T to C, chromosome 19 at 6,907,264 bp
  • T to A, chromosome 19 at 13,654,852 bp
  • T to C, chromosome 19 at 34,494,077 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8338 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067730-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.