Strain Name:
C57BL/6J-MtgxR8338Btlr/Mmmh
Stock Number:
067730-MU
Citation ID:
RRID:MMRRC_067730-MU
Other Names:
R8338 (G1)
Major Collection:

Strain Information

Strap
Name: serine/threonine kinase receptor associated protein
Synonyms: C78091, Unrip
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20901
Homologene: 43881
Wsb1
Name: WD repeat and SOCS box-containing 1
Synonyms: 2700038M07Rik, 1110056B13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78889
Homologene: 9218
Lcat
Name: lecithin cholesterol acyltransferase
Synonyms: D8Wsu61e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16816
HGNC: HGNC:6522
Homologene: 68042
Chd1
Name: chromodomain helicase DNA binding protein 1
Synonyms: 4930525N21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12648
HGNC: HGNC:1915
Homologene: 68174
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Mib1
Name: MIB E3 ubiquitin protein ligase 1
Synonyms: Mib, E430019M12Rik, skeletrophin, mind bomb-1, mindbomb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225164
Homologene: 10810
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Fbxl17
Name: F-box and leucine-rich repeat protein 17
Synonyms: Fbx13, C130023C01Rik, 6330576B01Rik, Fbxo13
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50758
Homologene: 79859
Cobl
Name: cordon-bleu WH2 repeat
Synonyms: C530045F18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12808
Homologene: 9058
Bltp3a
Name: bridge-like lipid transfer protein family member 3A
Synonyms: 1110020K19Rik, F830021D11Rik, Uhrf1bp1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224648
Homologene: 9816
Bicd1
Name: BICD cargo adaptor 1
Synonyms: B830009D06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12121
HGNC: HGNC:1049
Homologene: 37518
Ckap2l
Name: cytoskeleton associated protein 2-like
Synonyms: 2010016H04Rik, 2610318C08Rik, Radmis
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70466
Homologene: 51866
Ptprj
Name: protein tyrosine phosphatase receptor type J
Synonyms: Byp, DEP-1, Scc-1, Scc1, CD148, RPTPJ
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19271
HGNC: HGNC:9673
Homologene: 2130
Grm4
Name: glutamate receptor, metabotropic 4
Synonyms: mGluR4, Gprc1d
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268934
HGNC: HGNC:4596
Homologene: 20230
Myt1
Name: myelin transcription factor 1
Synonyms: NZF-2b, NZF-2a, Nztf2, Nzf2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17932
HGNC: HGNC:7622
Homologene: 3332
Il2ra
Name: interleukin 2 receptor, alpha chain
Synonyms: IL-2R alpha chain, CD25, Ly-43, Il2r
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16184
HGNC: HGNC:6008
Homologene: 360
Paxbp1
Name: PAX3 and PAX7 binding protein 1
Synonyms: 1810007M14Rik, Pax3/7bp, Gcfc1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67367
Homologene: 9604
Spats2
Name: spermatogenesis associated, serine-rich 2
Synonyms: 2700012F11Rik, p59scr, 59kDa, Scr59
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72572
VEGA: 15
Homologene: 11314
Tbc1d32
Name: TBC1 domain family, member 32
Synonyms: Bromi, C6orf170, D630037F22Rik, b2b2284Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 544696
VEGA: 10
Homologene: 51889
Uggt1
Name: UDP-glucose glycoprotein glucosyltransferase 1
Synonyms: C820010P03Rik, 0910001L17Rik, A930007H10Rik, Ugcgl1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320011
Homologene: 10586
Tmem98
Name: transmembrane protein 98
Synonyms: 6530411B15Rik, Rwhs
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103743
Homologene: 9185
Synj2bp
Name: synaptojanin 2 binding protein
Synonyms: OMP25, ARIP2, activin receptor interacting protein 2, D12Wsu118e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 24071
Homologene: 10161
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Cubn
Name: cubilin
Synonyms: D2Wsu88e, intrinsic factor-cobalamin receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Cyp7b1
Name: cytochrome P450, family 7, subfamily b, polypeptide 1
Synonyms: hct-1, D3Ertd552e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13123
HGNC: HGNC:2652
Homologene: 3544
Ostn
Name: osteocrin
Synonyms: Ostc, musclin
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239790
Homologene: 45675
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Arap3
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
Synonyms: DRAG1, E030006K04Rik, Centd3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106952
VEGA: 18
Homologene: 11199
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
V1rd19
Name: vomeronasal 1 receptor, D19
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404287
Homologene: 104166
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Tnn
Name: tenascin N
Synonyms: Tnw, tenascin-W
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329278
Homologene: 18634
Cfap44
Name: cilia and flagella associated protein 44
Synonyms: 6330444M21Rik, D16Ertd642e, Wdr52
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 212517
Homologene: 75085
Sdr16c6
Name: short chain dehydrogenase/reductase family 16C, member 6
Synonyms: 4833413O15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242286
Homologene: 135698
Lrp4
Name: low density lipoprotein receptor-related protein 4
Synonyms: 6430526J12Rik, Megf7, mdig
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228357
HGNC: HGNC:6696
Homologene: 17964
Il5ra
Name: interleukin 5 receptor, alpha
Synonyms: IL-5 receptor alpha chain, CD125, Il5r, CDw125
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16192
HGNC: HGNC:6017
Homologene: 473
Treh
Name: trehalase (brush-border membrane glycoprotein)
Synonyms: 2210412M19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 58866
Homologene: 5198
Man1a
Name: mannosidase 1, alpha
Synonyms: PCR1, mannosyl-oligosaccharide alpha-1,2-mannosidase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17155
HGNC: HGNC:6821
Homologene: 4316
Morc2b
Name: microrchidia 2B
Synonyms: 4932411A10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240069
Homologene: 18615
Ache
Name: acetylcholinesterase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11423
HGNC: HGNC:108
Homologene: 543
Stxbp5l
Name: syntaxin binding protein 5-like
Synonyms: t2md1, LLGL4, A830015P08Rik, insulin level locus 1, tomosyn-2, T2dm1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207227
Homologene: 18173
Rfx6
Name: regulatory factor X, 6
Synonyms: 4930572O07Rik, Rfxdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320995
Homologene: 18318
Lipa
Name: lysosomal acid lipase A
Synonyms: Lal, Lip-1, Lip1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16889
VEGA: 19
HGNC: HGNC:6617
Homologene: 37277
Snrpe
Name: small nuclear ribonucleoprotein E
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20643
Homologene: 37729
Or10w1
Name: olfactory receptor family 10 subfamily W member 1
Synonyms: GA_x6K02T2RE5P-3987000-3987950, MOR266-6P, Olfr1490
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258098
Homologene: 79418
Shroom1
Name: shroom family member 1
Synonyms: 1300007L22Rik, Shrm1, Apx
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71774
Homologene: 12411
St18
Name: suppression of tumorigenicity 18
Synonyms: Nzf3, Myt3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240690
Homologene: 8792
Nod1
Name: nucleotide-binding oligomerization domain containing 1
Synonyms: F830007N14Rik, Card4, Nlrc1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107607
Homologene: 4440
Fam171a2
Name: family with sequence similarity 171, member A2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217219
Homologene: 19144
Kif14
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381293
Homologene: 8916
Pdzrn3
Name: PDZ domain containing RING finger 3
Synonyms: semaphorin cytoplasmic domain-associated protein 3A, 1110020C07Rik, LNX3, Semcap3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 55983
Homologene: 10328
Celsr3
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: Fmi1, flamingo, Adgrc3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 107934
HGNC: HGNC:3230
Homologene: 1077
Rccd1
Name: RCC1 domain containing 1
Synonyms: E430018M08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269955
Homologene: 16782
Wdhd1
Name: WD repeat and HMG-box DNA binding protein 1
Synonyms: AND-1, D630024B06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218973
Homologene: 56019
Pcdhb14
Name: protocadherin beta 14
Synonyms: Pcdhb17, PcdhbN, 2210006M07Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93885
Homologene: 70876
Spopfm1
Name: speckle-type BTB/POZ protein family member 1
Synonyms: Gm4778
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 212727
Or8k27
Name: olfactory receptor family 8 subfamily K member 27
Synonyms: GA_x6K02T2Q125-47915274-47914333, MOR190-1, Olfr1065
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258403
Homologene: 74195
Or13a27
Name: olfactory receptor family 13 subfamily A member 27
Synonyms: IH6, MOR253-6, GA_x6K02T2PBJ9-42496183-42495251, Olfr60
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18361
Homologene: 34961
Cfap157
Name: cilia and flagella associated protein 157
Synonyms: 1700019L03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227736
Homologene: 53056
Isg15
Name: ISG15 ubiquitin-like modifier
Synonyms: G1p2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100038882
VEGA: 4
HGNC: HGNC:4053
Homologene: 48326
Or14c44
Name: olfactory receptor family 14 subfamily C member 44
Synonyms: GA_x6K02T2NHDJ-9693313-9692378, MOR221-1P, MOR211-8P, MOR221-4, MOR221-1P, Olfr1531-ps1, Olfr301, GA_x6K02T2NHDJ-9695951-9695766, Olfr302
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257958
Homologene: 128067
Or9a4
Name: olfactory receptor family 9 subfamily A member 4
Synonyms: GA_x6K02T2P3E9-6947292-6946348, MOR120-2, Olfr460
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258381
Homologene: 64866
Cryge
Name: crystallin, gamma E
Synonyms: Cryg-6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12968
HGNC: HGNC:2411
Homologene: 128417
Cers1
Name: ceramide synthase 1
Synonyms: Uog-1, CerS1, to, Lass1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93898
Homologene: 128762
Bcl11a
Name: BCL11 transcription factor A
Synonyms: COUP-TF interacting protein 1, CTIP1, mouse myeloid leukemia gene, Evi9, 2810047E18Rik, D930021L15Rik, Evi9c, Evi9b, Evi9a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14025
Homologene: 11284
Dnajc22
Name: DnaJ heat shock protein family (Hsp40) member C22
Synonyms: 2810451A06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72778
Homologene: 11777
C2cd6
Name: C2 calcium dependent domain containing 6
Synonyms: 1700052H20Rik, 4930408G06Rik, Als2cr11, Als2cr11b, Gm33589, C2cd6b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73463
Homologene: 134310
Prdx5
Name: peroxiredoxin 5
Synonyms: peroxiredoxin V, PrxV, PrxV, PMP20, Prdx6, AOPP, AOEB166
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54683
HGNC: HGNC:9355
Homologene: 8076
Msantd5f1
Name: Myb/SANT DNA binding domain containing 5 family member 1
Synonyms: LOC242502, Gm428
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242502
Homologene: 128423
Igkv12-98
Name: immunoglobulin kappa variable 12-98
Synonyms: Gm16636
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 435900
Gm13272
Name: predicted gene 13272
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 545648
Homologene: 45671
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 6,809,292 bp
  • A to G, chromosome 1 at 36,227,521 bp
  • A to C, chromosome 1 at 59,060,575 bp
  • G to A, chromosome 1 at 65,048,774 bp
  • A to G, chromosome 1 at 133,608,943 bp
  • C to A, chromosome 1 at 136,494,678 bp
  • G to A, chromosome 1 at 150,738,734 bp
  • C to T, chromosome 1 at 160,118,483 bp
  • A to T, chromosome 2 at 11,683,074 bp
  • A to C, chromosome 2 at 13,430,847 bp
  • G to T, chromosome 2 at 32,778,006 bp
  • T to G, chromosome 2 at 76,919,792 bp
  • A to T, chromosome 2 at 86,445,385 bp
  • A to T, chromosome 2 at 90,471,137 bp
  • A to G, chromosome 2 at 91,492,368 bp
  • T to G, chromosome 2 at 129,285,019 bp
  • A to T, chromosome 2 at 181,801,862 bp
  • T to C, chromosome 3 at 18,097,566 bp
  • A to G, chromosome 3 at 94,265,978 bp
  • C to T, chromosome 4 at 4,076,620 bp
  • T to A, chromosome 4 at 73,687,198 bp
  • A to C, chromosome 4 at 88,780,127 bp
  • G to A, chromosome 4 at 156,168,561 bp
  • T to A, chromosome 4 at 156,199,631 bp
  • A to G, chromosome 5 at 124,832,502 bp
  • T to C, chromosome 5 at 137,291,744 bp
  • C to T, chromosome 5 at 150,359,051 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • T to A, chromosome 6 at 30,140,248 bp
  • T to C, chromosome 6 at 40,571,976 bp
  • A to T, chromosome 6 at 54,943,971 bp
  • G to A, chromosome 6 at 68,571,175 bp
  • A to T, chromosome 6 at 101,150,822 bp
  • G to T, chromosome 6 at 106,712,389 bp
  • A to T, chromosome 6 at 137,741,978 bp
  • G to A, chromosome 6 at 149,513,123 bp
  • A to T, chromosome 7 at 24,003,249 bp
  • A to T, chromosome 7 at 80,320,870 bp
  • T to C, chromosome 7 at 86,412,494 bp
  • T to C, chromosome 7 at 120,071,881 bp
  • T to A, chromosome 7 at 140,345,393 bp
  • A to G, chromosome 8 at 70,331,122 bp
  • G to A, chromosome 8 at 105,940,087 bp
  • A to G, chromosome 9 at 44,684,511 bp
  • C to T, chromosome 9 at 108,827,340 bp
  • T to A, chromosome 10 at 51,718,094 bp
  • T to A, chromosome 10 at 53,925,547 bp
  • T to A, chromosome 10 at 56,028,077 bp
  • T to C, chromosome 11 at 12,253,696 bp
  • G to C, chromosome 11 at 24,164,578 bp
  • A to G, chromosome 11 at 53,463,280 bp
  • C to A, chromosome 11 at 65,841,241 bp
  • C to T, chromosome 11 at 69,487,296 bp
  • T to C, chromosome 11 at 79,246,277 bp
  • T to C, chromosome 11 at 80,821,309 bp
  • T to A, chromosome 11 at 102,438,346 bp
  • G to A, chromosome 12 at 81,504,552 bp
  • T to C, chromosome 14 at 47,268,663 bp
  • T to A, chromosome 14 at 103,135,265 bp
  • C to A, chromosome 15 at 99,101,141 bp
  • T to A, chromosome 15 at 99,178,459 bp
  • G to T, chromosome 16 at 27,324,535 bp
  • G to T, chromosome 16 at 37,174,356 bp
  • G to A, chromosome 16 at 44,419,335 bp
  • A to T, chromosome 16 at 91,036,547 bp
  • A to G, chromosome 17 at 15,769,980 bp
  • A to T, chromosome 17 at 27,435,003 bp
  • A to G, chromosome 17 at 27,876,695 bp
  • A to T, chromosome 17 at 33,136,413 bp
  • T to C, chromosome 17 at 63,356,758 bp
  • A to G, chromosome 18 at 10,726,372 bp
  • A to G, chromosome 18 at 31,971,355 bp
  • G to T, chromosome 18 at 37,449,122 bp
  • A to G, chromosome 18 at 37,973,630 bp
  • T to C, chromosome 19 at 6,907,264 bp
  • T to A, chromosome 19 at 13,654,852 bp
  • T to C, chromosome 19 at 34,494,077 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8338 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067730-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.