Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8352Btlr/Mmmh
Stock Number:
067733-MU
Citation ID:
RRID:MMRRC_067733-MU
Other Names:
R8352 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Mysm1
Name: myb-like, SWIRM and MPN domains 1
Synonyms: C530050H10Rik, C130067A03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320713
Homologene: 66204
Prex2
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Synonyms: 6230420N16Rik, C030045D06Rik, Depdc2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 109294
Homologene: 23523
Cdkal1
Name: CDK5 regulatory subunit associated protein 1-like 1
Synonyms: 6620401C13Rik, 1190005B03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68916
Homologene: 9830
Tbc1d8
Name: TBC1 domain family, member 8
Synonyms: BUB2-like protein 1, HBLP1, AD3, GRAM domain
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54610
Homologene: 31421
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Lrrfip1
Name: leucine rich repeat (in FLII) interacting protein 1
Synonyms: FLAP (FLI LRR associated protein), Fliiap1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16978
HGNC: HGNC:6702
Homologene: 48301
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Gpr165
Name: G protein-coupled receptor 165
Synonyms: 6530406P05Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 76206
Homologene: 85287
Apc
Name: APC, WNT signaling pathway regulator
Synonyms: Min, CC1, adenomatosis polyposis coli
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 11789
HGNC: HGNC:583
Homologene: 30950
Dpys
Name: dihydropyrimidinase
Synonyms: DHPase, 1300004I01Rik, 1200017I10Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 64705
HGNC: HGNC:3013
Homologene: 20359
Slc12a9
Name: solute carrier family 12 (potassium/chloride transporters), member 9
Synonyms: CIP1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83704
Homologene: 5429
Ppp2r5c
Name: protein phosphatase 2, regulatory subunit B', gamma
Synonyms: Band 8A, 2610043M05Rik, 2700063L20Rik, D12Bwg0916e, B56/PP2A gamma
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 26931
VEGA: 12
HGNC: HGNC:9311
Homologene: 128665
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
1700123K08Rik
Name: RIKEN cDNA 1700123K08 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76658
Homologene: 86127
Bud13
Name: BUD13 homolog
Synonyms: D030060M11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215051
Homologene: 13102
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Scy, Crsh, crash, Adgrc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Mttp
Name: microsomal triglyceride transfer protein
Synonyms: MTP, 1810043K16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17777
HGNC: HGNC:7467
Homologene: 212
Or52h1
Name: olfactory receptor family 52 subfamily H member 1
Synonyms: GA_x6K02T2PBJ9-6914780-6913830, MOR31-12, Olfr648
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258746
Homologene: 82999
Cntnap5c
Name: contactin associated protein-like 5C
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 620292
VEGA: 17
Homologene: 128806
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Unc13c
Name: unc-13 homolog C
Synonyms: Munc13-3, Unc13h3, D9Ertd414e, 1500037O19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208898
Homologene: 45443
Vmn2r26
Name: vomeronasal 2, receptor 26
Synonyms: V2r1b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56552
Homologene: 135915
Tnxb
Name: tenascin XB
Synonyms: Tnx, TN-MHC
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 81877
Homologene: 49589
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74183
Homologene: 135954
Morc2b
Name: microrchidia 2B
Synonyms: 4932411A10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240069
Homologene: 18615
Rev3l
Name: REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms: Sez4, Rev
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19714
HGNC: HGNC:9968
Homologene: 48147
Pcdh18
Name: protocadherin 18
Synonyms: PCDH68L
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73173
Homologene: 10389
Pign
Name: phosphatidylinositol glycan anchor biosynthesis, class N
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 27392
HGNC: HGNC:8967
Homologene: 6330
Pik3cg
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma
Synonyms: PI3Kgamma, p110gamma, PI3Kgamma, PI(3)Kgamma, 5830428L06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 30955
HGNC: HGNC:8978
Homologene: 68269
Dlg5
Name: discs large MAGUK scaffold protein 5
Synonyms: 4933429D20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71228
HGNC: HGNC:2904
Homologene: 3486
Prex1
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
Synonyms: P-REX1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277360
Homologene: 10821
Nrdc
Name: nardilysin convertase
Synonyms: NRD-C, Nrd1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230598
HGNC: HGNC:7995
Homologene: 68260
Or52n4
Name: olfactory receptor family 52 subfamily N member 4
Synonyms: GA_x6K02T2PBJ9-7273558-7272587, MOR34-5, Olfr658
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259051
Homologene: 105161
Rnf180
Name: ring finger protein 180
Synonyms: 3110001E11Rik, Rines
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 71816
VEGA: 13
Homologene: 18677
Or8c11
Name: olfactory receptor family 8 subfamily C member 11
Synonyms: GA_x6K02T2MYUG-9124-8183, MOR170-15, MOR170-13, MOR170-2, GA_x6K02T2PVTD-32071567-32072508, Olfr900, Olfr251
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 404313
VEGA: 9
Homologene: 133654
Actl7b
Name: actin-like 7b
Synonyms: Tact1, t-actin 1, ENSMUSG00000070980
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11471
HGNC: HGNC:162
Homologene: 21330
Mrgpra4
Name: MAS-related GPR, member A4
Synonyms: MrgA4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 235854
Homologene: 131159
Pacrg
Name: PARK2 co-regulated
Synonyms: 1700008H23Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69310
Homologene: 16212
Sirpb1b
Name: signal-regulatory protein beta 1B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 668101
Homologene: 82993
Prl3c1
Name: prolactin family 3, subfamily c, member 1
Synonyms: PLP-J, PLP I, Prlpj
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 27372
Homologene: 49353
Prr22
Name: proline rich 22
Synonyms: LOC224908, Gm546
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100504446
Homologene: 51921
Or7g19
Name: olfactory receptor family 7 subfamily G member 19
Synonyms: GA_x6K02T2PVTD-12687800-12688738, MOR153-1, Olfr832
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258075
HGNC: HGNC:8467
Homologene: 128143
Cyp2t4
Name: cytochrome P450, family 2, subfamily t, polypeptide 4
Synonyms: LOC384724
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384724
Homologene: 76639
Ifi213
Name: interferon activated gene 213
Synonyms: E030037K03Rik, Pydc4, Pyr-A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 623121
HGNC: HGNC:5395
Homologene: 115929
Cyp8b1
Name: cytochrome P450, family 8, subfamily b, polypeptide 1
Synonyms: sterol 12-alpha-hydrolase
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13124
HGNC: HGNC:2653
Homologene: 3233
Nrip2
Name: nuclear receptor interacting protein 2
Synonyms: NIX1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 60345
Homologene: 11023
Scn4b
Name: sodium channel, type IV, beta
Synonyms: LOC384934
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 399548
Homologene: 18384
Tfec
Name: transcription factor EC
Synonyms: TFEC, bHLHe34, Tcfec
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21426
Homologene: 32148
Bola1
Name: bolA family member 1
Synonyms: 1810037G04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69168
Homologene: 41103
Fam187a
Name: family with sequence similarity 187, member A
Synonyms: 4933439F11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66784
Homologene: 128440
Cox8b
Name: cytochrome c oxidase subunit 8B
Synonyms: COX8H, COX VIII-H
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12869
Homologene: 7277
H2bc7
Name: H2B clustered histone 7
Synonyms: Hist1h2bf
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319180
Homologene: 136770
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 11,285,139 bp
  • T to G, chromosome 1 at 11,285,140 bp
  • G to T, chromosome 1 at 39,405,357 bp
  • T to C, chromosome 1 at 53,427,827 bp
  • T to C, chromosome 1 at 90,998,819 bp
  • A to G, chromosome 1 at 105,648,192 bp
  • T to C, chromosome 1 at 173,595,269 bp
  • T to A, chromosome 2 at 76,738,487 bp
  • A to T, chromosome 2 at 82,984,593 bp
  • A to T, chromosome 2 at 166,589,573 bp
  • T to A, chromosome 3 at 15,542,350 bp
  • A to T, chromosome 3 at 49,745,175 bp
  • G to A, chromosome 3 at 96,197,257 bp
  • A to T, chromosome 3 at 138,112,613 bp
  • T to A, chromosome 4 at 56,740,251 bp
  • A to G, chromosome 4 at 94,975,273 bp
  • T to A, chromosome 4 at 109,019,063 bp
  • A to T, chromosome 4 at 143,437,477 bp
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp
  • C to A, chromosome 5 at 137,315,475 bp
  • G to A, chromosome 5 at 138,562,926 bp
  • T to A, chromosome 6 at 16,844,203 bp
  • A to G, chromosome 6 at 124,039,618 bp
  • A to T, chromosome 6 at 128,407,994 bp
  • G to A, chromosome 7 at 27,157,737 bp
  • T to A, chromosome 7 at 47,981,677 bp
  • A to T, chromosome 7 at 104,179,896 bp
  • A to T, chromosome 7 at 104,644,529 bp
  • T to A, chromosome 7 at 140,899,016 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to A, chromosome 9 at 18,945,163 bp
  • A to T, chromosome 9 at 38,378,351 bp
  • A to T, chromosome 9 at 45,146,741 bp
  • A to G, chromosome 9 at 46,288,079 bp
  • A to G, chromosome 9 at 73,931,008 bp
  • A to G, chromosome 9 at 121,915,931 bp
  • A to T, chromosome 10 at 12,813,509 bp
  • A to G, chromosome 10 at 39,822,903 bp
  • A to G, chromosome 11 at 36,023,601 bp
  • C to A, chromosome 11 at 102,886,574 bp
  • A to G, chromosome 12 at 32,193,640 bp
  • T to A, chromosome 12 at 110,544,077 bp
  • A to G, chromosome 13 at 23,574,045 bp
  • T to A, chromosome 13 at 27,202,402 bp
  • G to A, chromosome 13 at 29,354,680 bp
  • A to T, chromosome 13 at 105,181,548 bp
  • G to T, chromosome 14 at 24,191,193 bp
  • T to C, chromosome 15 at 39,793,324 bp
  • G to T, chromosome 15 at 86,033,085 bp
  • T to A, chromosome 17 at 10,576,594 bp
  • T to C, chromosome 17 at 33,137,502 bp
  • A to T, chromosome 17 at 34,689,407 bp
  • G to A, chromosome 17 at 56,771,311 bp
  • C to T, chromosome 17 at 58,055,692 bp
  • A to G, chromosome 18 at 34,312,751 bp
  • C to A, chromosome X at 96,714,017 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8352 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067733-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.