Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8352Btlr/Mmmh
Stock Number:
067733-MU
Citation ID:
RRID:MMRRC_067733-MU
Other Names:
R8352 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Mysm1
Name: myb-like, SWIRM and MPN domains 1
Synonyms: C530050H10Rik, C130067A03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320713
Homologene: 66204
Prex2
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Synonyms: 6230420N16Rik, C030045D06Rik, Depdc2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 109294
Homologene: 23523
Cdkal1
Name: CDK5 regulatory subunit associated protein 1-like 1
Synonyms: 6620401C13Rik, 1190005B03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68916
Homologene: 9830
Tbc1d8
Name: TBC1 domain family, member 8
Synonyms: BUB2-like protein 1, HBLP1, AD3, GRAM domain
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54610
Homologene: 31421
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Lrrfip1
Name: leucine rich repeat (in FLII) interacting protein 1
Synonyms: FLAP (FLI LRR associated protein), Fliiap1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16978
HGNC: HGNC:6702
Homologene: 48301
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 11,285,139 bp
  • T to G, chromosome 1 at 11,285,140 bp
  • G to T, chromosome 1 at 39,405,357 bp
  • T to C, chromosome 1 at 53,427,827 bp
  • T to C, chromosome 1 at 90,998,819 bp
  • A to G, chromosome 1 at 105,648,192 bp
  • T to C, chromosome 1 at 173,595,269 bp
  • T to A, chromosome 2 at 76,738,487 bp
  • A to T, chromosome 2 at 82,984,593 bp
  • A to T, chromosome 2 at 166,589,573 bp
  • T to A, chromosome 3 at 15,542,350 bp
  • A to T, chromosome 3 at 49,745,175 bp
  • G to A, chromosome 3 at 96,197,257 bp
  • A to T, chromosome 3 at 138,112,613 bp
  • T to A, chromosome 4 at 56,740,251 bp
  • A to G, chromosome 4 at 94,975,273 bp
  • T to A, chromosome 4 at 109,019,063 bp
  • A to T, chromosome 4 at 143,437,477 bp
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp
  • C to A, chromosome 5 at 137,315,475 bp
  • G to A, chromosome 5 at 138,562,926 bp
  • T to A, chromosome 6 at 16,844,203 bp
  • A to G, chromosome 6 at 124,039,618 bp
  • A to T, chromosome 6 at 128,407,994 bp
  • G to A, chromosome 7 at 27,157,737 bp
  • T to A, chromosome 7 at 47,981,677 bp
  • A to T, chromosome 7 at 104,179,896 bp
  • A to T, chromosome 7 at 104,644,529 bp
  • T to A, chromosome 7 at 140,899,016 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to A, chromosome 9 at 18,945,163 bp
  • A to T, chromosome 9 at 38,378,351 bp
  • A to T, chromosome 9 at 45,146,741 bp
  • A to G, chromosome 9 at 46,288,079 bp
  • A to G, chromosome 9 at 73,931,008 bp
  • A to G, chromosome 9 at 121,915,931 bp
  • A to T, chromosome 10 at 12,813,509 bp
  • A to G, chromosome 10 at 39,822,903 bp
  • A to G, chromosome 11 at 36,023,601 bp
  • C to A, chromosome 11 at 102,886,574 bp
  • A to G, chromosome 12 at 32,193,640 bp
  • T to A, chromosome 12 at 110,544,077 bp
  • A to G, chromosome 13 at 23,574,045 bp
  • T to A, chromosome 13 at 27,202,402 bp
  • G to A, chromosome 13 at 29,354,680 bp
  • A to T, chromosome 13 at 105,181,548 bp
  • G to T, chromosome 14 at 24,191,193 bp
  • T to C, chromosome 15 at 39,793,324 bp
  • G to T, chromosome 15 at 86,033,085 bp
  • T to A, chromosome 17 at 10,576,594 bp
  • T to C, chromosome 17 at 33,137,502 bp
  • A to T, chromosome 17 at 34,689,407 bp
  • G to A, chromosome 17 at 56,771,311 bp
  • C to T, chromosome 17 at 58,055,692 bp
  • A to G, chromosome 18 at 34,312,751 bp
  • C to A, chromosome X at 96,714,017 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8352 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067733-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.