Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8383Btlr/Mmmh
Stock Number:
067749-MU
Citation ID:
RRID:MMRRC_067749-MU
Other Names:
R8383 (G1)
Major Collection:

Strain Information

Tyr
Name: tyrosinase
Synonyms: skc35, Oca1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22173
Homologene: 30969
Sgca
Name: sarcoglycan, alpha (dystrophin-associated glycoprotein)
Synonyms: adhalin, 50DAG, Asg
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20391
Homologene: 9
Ip6k1
Name: inositol hexaphosphate kinase 1
Synonyms: InsP6, 1200016D08Rik, Ihpk1, InsP6k1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 27399
Homologene: 56602
Nrxn2
Name: neurexin II
Synonyms: neurexin II beta, neurexin II alpha, 6430591O13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Kmt2e
Name: lysine (K)-specific methyltransferase 2E
Synonyms: 1810033J14Rik, D230038D11Rik, 9530077A04Rik, Mll5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69188
Homologene: 18822
Plekha7
Name: pleckstrin homology domain containing, family A member 7
Synonyms: A430081P20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233765
Homologene: 52172
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 75,503,857 bp
  • T to A, chromosome 1 at 173,683,509 bp
  • GAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG to GGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG, chromosome 1 at 173,729,204 bp
  • A to T, chromosome 2 at 36,569,002 bp
  • A to G, chromosome 2 at 36,870,331 bp
  • A to G, chromosome 2 at 86,786,530 bp
  • A to G, chromosome 2 at 153,393,719 bp
  • A to C, chromosome 3 at 41,742,015 bp
  • A to T, chromosome 3 at 93,332,346 bp
  • T to G, chromosome 3 at 100,085,392 bp
  • A to T, chromosome 3 at 127,724,436 bp
  • T to C, chromosome 4 at 96,348,458 bp
  • A to G, chromosome 4 at 135,734,140 bp
  • T to A, chromosome 4 at 137,544,370 bp
  • A to G, chromosome 4 at 146,466,676 bp
  • A to G, chromosome 5 at 23,485,541 bp
  • C to T, chromosome 5 at 120,666,355 bp
  • A to T, chromosome 5 at 121,607,373 bp
  • C to T, chromosome 5 at 146,558,418 bp
  • A to T, chromosome 6 at 18,868,411 bp
  • T to C, chromosome 6 at 55,480,000 bp
  • A to G, chromosome 6 at 70,607,750 bp
  • T to A, chromosome 6 at 84,019,583 bp
  • T to C, chromosome 7 at 6,305,371 bp
  • C to T, chromosome 7 at 43,970,343 bp
  • A to T, chromosome 7 at 87,483,992 bp
  • A to C, chromosome 7 at 116,144,919 bp
  • T to C, chromosome 8 at 105,894,426 bp
  • T to C, chromosome 8 at 111,169,562 bp
  • G to A, chromosome 9 at 20,822,785 bp
  • G to A, chromosome 9 at 21,977,233 bp
  • G to T, chromosome 9 at 35,029,883 bp
  • T to A, chromosome 9 at 37,666,753 bp
  • C to T, chromosome 9 at 44,337,943 bp
  • T to A, chromosome 9 at 108,044,727 bp
  • A to G, chromosome 10 at 30,840,669 bp
  • A to G, chromosome 10 at 86,719,526 bp
  • T to A, chromosome 11 at 14,599,353 bp
  • A to G, chromosome 11 at 69,406,050 bp
  • G to A, chromosome 11 at 70,551,429 bp
  • T to G, chromosome 11 at 73,289,301 bp
  • ACAGCAGCAGCAGCAGCAGCAGC to ACAGCAGCAGCAGCAGCAGC, chromosome 11 at 94,214,377 bp
  • G to A, chromosome 11 at 94,972,242 bp
  • A to G, chromosome 12 at 72,109,178 bp
  • A to G, chromosome 12 at 100,835,329 bp
  • A to G, chromosome 14 at 42,311,364 bp
  • A to G, chromosome 14 at 55,074,071 bp
  • TG to T, chromosome 14 at 56,424,542 bp
  • T to C, chromosome 14 at 87,506,308 bp
  • A to G, chromosome 16 at 5,077,358 bp
  • T to C, chromosome 16 at 18,472,864 bp
  • A to G, chromosome 17 at 22,851,824 bp
  • A to T, chromosome 18 at 63,084,688 bp
  • G to T, chromosome 18 at 65,305,398 bp
  • A to G, chromosome 18 at 67,775,056 bp
  • A to G, chromosome 18 at 74,643,978 bp
  • A to G, chromosome 19 at 6,472,313 bp
  • A to T, chromosome 19 at 16,723,705 bp
  • G to A, chromosome 19 at 56,316,336 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8383 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067749-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.