Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8383Btlr/Mmmh
Stock Number:
067749-MU
Citation ID:
RRID:MMRRC_067749-MU
Other Names:
R8383 (G1)
Major Collection:

Strain Information

Tyr
Name: tyrosinase
Synonyms: skc35, Oca1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22173
Homologene: 30969
Sgca
Name: sarcoglycan, alpha (dystrophin-associated glycoprotein)
Synonyms: adhalin, 50DAG, Asg
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20391
Homologene: 9
Ip6k1
Name: inositol hexaphosphate kinase 1
Synonyms: InsP6, 1200016D08Rik, Ihpk1, InsP6k1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 27399
Homologene: 56602
Nrxn2
Name: neurexin II
Synonyms: neurexin II beta, neurexin II alpha, 6430591O13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Kmt2e
Name: lysine (K)-specific methyltransferase 2E
Synonyms: 1810033J14Rik, D230038D11Rik, 9530077A04Rik, Mll5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69188
Homologene: 18822
Plekha7
Name: pleckstrin homology domain containing, family A member 7
Synonyms: A430081P20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233765
Homologene: 52172
Asxl1
Name: ASXL transcriptional regulator 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228790
Homologene: 9098
Tdrd3
Name: tudor domain containing 3
Synonyms: 4732418C03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219249
Homologene: 12771
Ubn1
Name: ubinuclein 1
Synonyms: 1110029L11Rik, 2610108L02Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 170644
VEGA: 16
Homologene: 9656
Rnf17
Name: ring finger protein 17
Synonyms: MMIP-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 30054
VEGA: 14
Homologene: 23727
Hey2
Name: hairy/enhancer-of-split related with YRPW motif 2
Synonyms: CHF1, Hrt2, Herp1, Hesr2, bHLHb32
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15214
HGNC: HGNC:4881
Homologene: 22705
Rasal1
Name: RAS protein activator like 1 (GAP1 like)
Synonyms: MRASAL
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19415
HGNC: HGNC:9873
Homologene: 3423
Zfp992
Name: zinc finger protein 992
Synonyms: Gm13251
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433791
Homologene: 133076
Seh1l
Name: SEH1-like (S. cerevisiae
Synonyms: 2610007A16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 72124
VEGA: 18
Homologene: 68701
Il22ra1
Name: interleukin 22 receptor, alpha 1
Synonyms: Il22r
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230828
Homologene: 10943
Kirrel3
Name: kirre like nephrin family adhesion molecule 3
Synonyms: Neph2, 1500010O20Rik, 2900036G11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67703
Homologene: 57050
Nrn1l
Name: neuritin 1-like
Synonyms: G630049C14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234700
Homologene: 18397
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: per, Pcn, Plc, perlecan
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Glg1
Name: golgi apparatus protein 1
Synonyms: ESL-1, CFR, MG-160, MG160, CFR-1, Selel
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20340
HGNC: HGNC:4316
Homologene: 7533
Tob1
Name: transducer of ErbB-2.1
Synonyms: Trob, Tob
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22057
Homologene: 31334
Zfp667
Name: zinc finger protein 667
Synonyms: A830025F02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384763
Homologene: 23343
Vps13a
Name: vacuolar protein sorting 13A
Synonyms: 4930516E05Rik, D330038K10Rik, 4930543C13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 271564
VEGA: 19
HGNC: HGNC:1908
Homologene: 22068
Kdm6b
Name: KDM1 lysine (K)-specific demethylase 6B
Synonyms: Jmjd3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216850
Homologene: 18945
Zfhx2
Name: zinc finger homeobox 2
Synonyms: zfh-5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239102
Homologene: 52657
Hmbs
Name: hydroxymethylbilane synthase
Synonyms: porphobilinogen deaminase, PBGD, Uros1, Ups
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15288
VEGA: 9
HGNC: HGNC:4982
Homologene: 158
Piezo2
Name: piezo-type mechanosensitive ion channel component 2
Synonyms: 9430028L06Rik, 9030411M15Rik, Fam38b2, Piezo2, Fam38b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 667742
Homologene: 49695
Ccdc175
Name: coiled-coil domain containing 175
Synonyms: 4930403N07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73936
VEGA: 12
Homologene: 79144
Or1j20
Name: olfactory receptor family 1 subfamily J member 20
Synonyms: GA_x6K02T2NLDC-33564136-33565083, MOR136-10, Olfr352
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258942
Homologene: 121523
Cyp2j11
Name: cytochrome P450, family 2, subfamily j, polypeptide 11
Synonyms: Cyp2j11-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100066
HGNC: HGNC:2634
Homologene: 133819
Ifi208
Name: interferon activated gene 208
Synonyms: E430029J22Rik, Pydc3, Pyr-rv1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100033459
Homologene: 115929
Ankrd7
Name: ankyrin repeat domain 7
Synonyms: 4930532L20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75196
Homologene: 35506
Sclt1
Name: sodium channel and clathrin linker 1
Synonyms: 4931421F20Rik, 2610207F23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67161
Homologene: 27031
Ifi207
Name: interferon activated gene 207
Synonyms: AI607873, Pyhin-A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226691
HGNC: HGNC:5395
Homologene: 115929
Ttc41
Name: tetratricopeptide repeat domain 41
Synonyms: Gnn, BC030307
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103220
VEGA: 10
Homologene: 52968
Rgl3
Name: ral guanine nucleotide dissociation stimulator-like 3
Synonyms: 1300003D20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71746
VEGA: 9
Homologene: 11363
Or1j15
Name: olfactory receptor family 1 subfamily J member 15
Synonyms: GA_x6K02T2NLDC-33262744-33263673, MOR136-12, Olfr344
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258621
Acad12
Name: acyl-Coenzyme A dehydrogenase family, member 12
Synonyms: 9330129D05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 338350
Dglucy
Name: D-glutamate cyclase
Synonyms: 9030617O03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217830
Homologene: 11798
Alpk2
Name: alpha-kinase 2
Synonyms: Hak
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225638
Homologene: 50475
Trpv3
Name: transient receptor potential cation channel, subfamily V, member 3
Synonyms: 1110036I10Rik, VRL3, Nh
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246788
Homologene: 17040
Spag17
Name: sperm associated antigen 17
Synonyms: 4931427F14Rik, PF6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74362
Homologene: 52601
Hrnr
Name: hornerin
Synonyms: 1110033K19Rik, A530063N20Rik, S100a18
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68723
Homologene: 138092
Adcyap1r1
Name: adenylate cyclase activating polypeptide 1 receptor 1
Synonyms: PACAP1-R, PAC1, PAC1R, 2900024I10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11517
HGNC: HGNC:242
Homologene: 870
Klk1b1
Name: kallikrein 1-related peptidase b1
Synonyms: mGK-1, TK, tissue kallikrein, mK1, Klk1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16623
HGNC: HGNC:6357
Homologene: 68141
Or5t5
Name: olfactory receptor family 5 subfamily T member 5
Synonyms: GA_x6K02T2Q125-48278396-48279364, MOR179-6, Olfr1093
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258363
Homologene: 133610
Habp2
Name: hyaluronic acid binding protein 2
Synonyms: FSAP
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226243
HGNC: HGNC:4798
Homologene: 3050
Alpk1
Name: alpha-kinase 1
Synonyms: 8430410J10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71481
Homologene: 11849
Zfp945
Name: zinc finger protein 945
Synonyms: C730040L01Rik, A630033E08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240041
Homologene: 133214
Txnrd2
Name: thioredoxin reductase 2
Synonyms: ESTM573010, TR beta, TR3, TGR
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 26462
Homologene: 4701
Panx3
Name: pannexin 3
Synonyms: 4833413G11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208098
Homologene: 82335
Rdh8
Name: retinol dehydrogenase 8
Synonyms: LOC235033, prRDH
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235033
VEGA: 9
Homologene: 41062
Gm7995
Name: predicted gene 7995
Synonyms: Gm3586
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 666233
Homologene: 115686
Pom121l12
Name: POM121 membrane glycoprotein-like 12
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432536
Homologene: 136280
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 75,503,857 bp
  • T to A, chromosome 1 at 173,683,509 bp
  • GAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG to GGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG, chromosome 1 at 173,729,204 bp
  • A to T, chromosome 2 at 36,569,002 bp
  • A to G, chromosome 2 at 36,870,331 bp
  • A to G, chromosome 2 at 86,786,530 bp
  • A to G, chromosome 2 at 153,393,719 bp
  • A to C, chromosome 3 at 41,742,015 bp
  • A to T, chromosome 3 at 93,332,346 bp
  • T to G, chromosome 3 at 100,085,392 bp
  • A to T, chromosome 3 at 127,724,436 bp
  • T to C, chromosome 4 at 96,348,458 bp
  • A to G, chromosome 4 at 135,734,140 bp
  • T to A, chromosome 4 at 137,544,370 bp
  • A to G, chromosome 4 at 146,466,676 bp
  • A to G, chromosome 5 at 23,485,541 bp
  • C to T, chromosome 5 at 120,666,355 bp
  • A to T, chromosome 5 at 121,607,373 bp
  • C to T, chromosome 5 at 146,558,418 bp
  • A to T, chromosome 6 at 18,868,411 bp
  • T to C, chromosome 6 at 55,480,000 bp
  • A to G, chromosome 6 at 70,607,750 bp
  • T to A, chromosome 6 at 84,019,583 bp
  • T to C, chromosome 7 at 6,305,371 bp
  • C to T, chromosome 7 at 43,970,343 bp
  • A to T, chromosome 7 at 87,483,992 bp
  • A to C, chromosome 7 at 116,144,919 bp
  • T to C, chromosome 8 at 105,894,426 bp
  • T to C, chromosome 8 at 111,169,562 bp
  • G to A, chromosome 9 at 20,822,785 bp
  • G to A, chromosome 9 at 21,977,233 bp
  • G to T, chromosome 9 at 35,029,883 bp
  • T to A, chromosome 9 at 37,666,753 bp
  • C to T, chromosome 9 at 44,337,943 bp
  • T to A, chromosome 9 at 108,044,727 bp
  • A to G, chromosome 10 at 30,840,669 bp
  • A to G, chromosome 10 at 86,719,526 bp
  • T to A, chromosome 11 at 14,599,353 bp
  • A to G, chromosome 11 at 69,406,050 bp
  • G to A, chromosome 11 at 70,551,429 bp
  • T to G, chromosome 11 at 73,289,301 bp
  • ACAGCAGCAGCAGCAGCAGCAGC to ACAGCAGCAGCAGCAGCAGC, chromosome 11 at 94,214,377 bp
  • G to A, chromosome 11 at 94,972,242 bp
  • A to G, chromosome 12 at 72,109,178 bp
  • A to G, chromosome 12 at 100,835,329 bp
  • A to G, chromosome 14 at 42,311,364 bp
  • A to G, chromosome 14 at 55,074,071 bp
  • TG to T, chromosome 14 at 56,424,542 bp
  • T to C, chromosome 14 at 87,506,308 bp
  • A to G, chromosome 16 at 5,077,358 bp
  • T to C, chromosome 16 at 18,472,864 bp
  • A to G, chromosome 17 at 22,851,824 bp
  • A to T, chromosome 18 at 63,084,688 bp
  • G to T, chromosome 18 at 65,305,398 bp
  • A to G, chromosome 18 at 67,775,056 bp
  • A to G, chromosome 18 at 74,643,978 bp
  • A to G, chromosome 19 at 6,472,313 bp
  • A to T, chromosome 19 at 16,723,705 bp
  • G to A, chromosome 19 at 56,316,336 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8383 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067749-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.