Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8420Btlr/Mmmh
Stock Number:
067773-MU
Citation ID:
RRID:MMRRC_067773-MU
Other Names:
R8420 (G1)
Major Collection:

Strain Information

Prnp
Name: prion protein
Synonyms: PrP, PrPC, Prn-i, Prn-p, Sinc, PrPSc, CD230
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19122
HGNC: HGNC:9449
Homologene: 7904
Lrrn1
Name: leucine rich repeat protein 1, neuronal
Synonyms: NLRR-1, 2810047E21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16979
Homologene: 32036
Pigf
Name: phosphatidylinositol glycan anchor biosynthesis, class F
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18701
HGNC: HGNC:8962
Homologene: 31103
Dock9
Name: dedicator of cytokinesis 9
Synonyms: B230309H04Rik, D14Wsu89e, Zizimin1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105445
Homologene: 41026
Rtn4
Name: reticulon 4
Synonyms: 1110020G17Rik, C130026I10Rik, NOGO, NgA, Nogo-B, Nogo-A
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68585
Homologene: 10743
Ubr1
Name: ubiquitin protein ligase E3 component n-recognin 1
Synonyms: E3 alpha
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22222
Homologene: 7582
Xpo4
Name: exportin 4
Synonyms: B430309A01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57258
Homologene: 10733
Cenpf
Name: centromere protein F
Synonyms: 6530404A22Rik, Lek1, mitosin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108000
HGNC: HGNC:1857
Homologene: 22969
Atp9b
Name: ATPase, class II, type 9B
Synonyms: IIb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 50771
VEGA: 18
Homologene: 21915
Sec23b
Name: SEC23 homolog B, COPII coat complex component
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27054
Homologene: 74571
Naf1
Name: nuclear assembly factor 1 ribonucleoprotein
Synonyms: LOC234344
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234344
Homologene: 128518
Ccdc80
Name: coiled-coil domain containing 80
Synonyms: Urb, Ssg1, 2610001E17Rik, DRO1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67896
Homologene: 12206
Grm7
Name: glutamate receptor, metabotropic 7
Synonyms: mGluR7, Gpr1g, E130018M02Rik, 6330570A01Rik, mGlu7a receptor
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108073
HGNC: HGNC:4599
Homologene: 20233
Or4m1
Name: olfactory receptor family 4 subfamily M member 1
Synonyms: GA_x6K02T2PMLR-6013665-6012724, MOR242-1, Olfr734
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258658
Homologene: 51759
Zfp868
Name: zinc finger protein 868
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234362
Homologene: 74376
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Fam135a
Name: family with sequence similarity 135, member A
Synonyms: 4921533L14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68187
Homologene: 32665
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Tnfsf13b
Name: tumor necrosis factor (ligand) superfamily, member 13b
Synonyms: BAFF, zTNF4, BLyS, TALL-1, D8Ertd387e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 24099
Homologene: 48443
Syk
Name: spleen tyrosine kinase
Synonyms: Sykb
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20963
Homologene: 2390
Foxp2
Name: forkhead box P2
Synonyms: 2810043D05Rik, D0Kist7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 114142
Homologene: 134404
Exph5
Name: exophilin 5
Synonyms: slac2-b, B130009M24Rik, AC079869.22gm5, Slac2b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320051
Homologene: 9007
Slc13a5
Name: solute carrier family 13 (sodium-dependent citrate transporter), member 5
Synonyms: Nact, NaC2/NaCT, mINDY, Indy
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237831
Homologene: 21941
Kif1a
Name: kinesin family member 1A
Synonyms: Kns1, ATSV, N-3 kinesin, LOC381283, C630002N23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16560
HGNC: HGNC:888
Homologene: 99729
Skint5
Name: selection and upkeep of intraepithelial T cells 5
Synonyms: OTTMUSG00000008560
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242627
Homologene: 135888
Slc20a1
Name: solute carrier family 20, member 1
Synonyms: Glvr-1, Glvr1, PiT-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20515
Homologene: 38049
Eya2
Name: EYA transcriptional coactivator and phosphatase 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14049
HGNC: HGNC:3520
Homologene: 40711
Ptgfr
Name: prostaglandin F receptor
Synonyms: PGF, FP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19220
HGNC: HGNC:9600
Homologene: 741
C4b
Name: complement C4B (Chido blood group)
Synonyms: Ss, C4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12268
Homologene: 36030
Adrb2
Name: adrenergic receptor, beta 2
Synonyms: beta 2-AR, Badm, Adrb-2, beta 2-adrenoceptor, Gpcr7
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 11555
VEGA: 18
HGNC: HGNC:286
Homologene: 30948
Aatk
Name: apoptosis-associated tyrosine kinase
Synonyms: AATYK1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11302
HGNC: HGNC:21
Homologene: 74861
Mcrs1
Name: microspherule protein 1
Synonyms: P78, ICP22BP, MSP58, C78274
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 51812
VEGA: 15
HGNC: HGNC:6960
Homologene: 4622
Slc35g2
Name: solute carrier family 35, member G2
Synonyms: LOC245020, Tmem22
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245020
Homologene: 11893
Dmrt2
Name: doublesex and mab-3 related transcription factor 2
Synonyms: Terra
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226049
VEGA: 19
HGNC: HGNC:2935
Homologene: 17111
Or8k1
Name: olfactory receptor family 8 subfamily K member 1
Synonyms: GA_x6K02T2Q125-47692494-47691544, MOR194-1, Olfr1046
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258575
Homologene: 17301
Exd2
Name: exonuclease 3'-5' domain containing 2
Synonyms: 4930539P14Rik, Exdl2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 97827
VEGA: 12
Homologene: 10066
Cdh18
Name: cadherin 18
Synonyms: B230220E17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320865
HGNC: HGNC:1757
Homologene: 55858
Nid1
Name: nidogen 1
Synonyms: entactin, entactin 1, nidogen-1, entactin-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18073
VEGA: 13
HGNC: HGNC:7821
Homologene: 1878
Pde11a
Name: phosphodiesterase 11A
Synonyms: A630086N24Rik, 6330414F14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241489
HGNC: HGNC:8773
Homologene: 56763
4933416C03Rik
Name: RIKEN cDNA 4933416C03 gene
Type: Gene
Species: Mouse
Chromosome: 10
H6pd
Name: hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
Synonyms: Gpd-1, Gpd1, G6pd1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100198
HGNC: HGNC:4795
Homologene: 48275
Ceacam3
Name: CEA cell adhesion molecule 3
Synonyms: cea12, EG384557, Psg24
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384557
Homologene: 86971
Or2f2
Name: olfactory receptor family 2 subfamily F member 2
Synonyms: GA_x6K02T2P3E9-4769843-4768890, MOR257-5P, Olfr452
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258207
HGNC: HGNC:8247
Homologene: 128141
Ift27
Name: intraflagellar transport 27
Synonyms: 2600013G09Rik, Rabl4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67042
VEGA: 15
Homologene: 4998
Aph1b
Name: aph1 homolog B, gamma secretase subunit
Synonyms: 2310057K14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208117
Homologene: 12844
Zdhhc22
Name: zinc finger, DHHC-type containing 22
Synonyms: LOC238331
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238331
VEGA: 12
Homologene: 45486
Gzma
Name: granzyme A
Synonyms: serine esterase 1, TSP1, BLT esterase, Hanukah factor, Ctla-3, Hf, Ctla3, H factor, SE1, TSP-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14938
VEGA: 13
HGNC: HGNC:4708
Homologene: 21237
C1qbp
Name: complement component 1, q subcomponent binding protein
Synonyms: P32, HABP1, D11Wsu182e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12261
HGNC: HGNC:1243
Homologene: 31023
Vopp1
Name: vesicular, overexpressed in cancer, prosurvival protein 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232023
Homologene: 12772
Rap2b
Name: RAP2B, member of RAS oncogene family
Synonyms: 4021402C18Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74012
HGNC: HGNC:9862
Homologene: 55701
Or5h27
Name: olfactory receptor family 5 subfamily H member 27, pseudogene 1
Synonyms: GA_x54KRFPKG5P-55400292-55399363, MOR183-3, Olfr197
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258477
Homologene: 36984
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 24,028,488 bp
  • A to T, chromosome 1 at 93,022,419 bp
  • C to T, chromosome 1 at 189,672,585 bp
  • C to T, chromosome 2 at 76,059,010 bp
  • T to A, chromosome 2 at 86,217,113 bp
  • A to G, chromosome 2 at 120,870,995 bp
  • C to T, chromosome 2 at 129,199,864 bp
  • A to G, chromosome 2 at 131,936,749 bp
  • A to G, chromosome 2 at 144,559,314 bp
  • A to G, chromosome 2 at 165,767,068 bp
  • A to G, chromosome 3 at 61,364,384 bp
  • C to T, chromosome 3 at 151,835,416 bp
  • A to T, chromosome 4 at 113,580,482 bp
  • T to C, chromosome 4 at 149,981,676 bp
  • G to T, chromosome 6 at 15,403,867 bp
  • A to T, chromosome 6 at 42,790,710 bp
  • T to C, chromosome 6 at 57,762,394 bp
  • T to A, chromosome 6 at 107,569,333 bp
  • T to G, chromosome 6 at 111,080,354 bp
  • T to A, chromosome 7 at 17,161,683 bp
  • G to A, chromosome 8 at 10,006,795 bp
  • GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC to GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC, chromosome 8 at 66,860,548 bp
  • A to G, chromosome 8 at 69,611,509 bp
  • T to C, chromosome 9 at 18,537,511 bp
  • A to T, chromosome 9 at 53,375,848 bp
  • A to G, chromosome 9 at 66,794,221 bp
  • A to G, chromosome 9 at 100,553,171 bp
  • T to C, chromosome 10 at 116,112,535 bp
  • A to T, chromosome 11 at 8,870,277 bp
  • A to G, chromosome 11 at 29,707,300 bp
  • A to G, chromosome 11 at 70,978,717 bp
  • A to G, chromosome 11 at 72,257,384 bp
  • A to G, chromosome 11 at 120,046,920 bp
  • A to G, chromosome 12 at 80,475,997 bp
  • A to C, chromosome 12 at 86,988,369 bp
  • C to A, chromosome 13 at 13,437,831 bp
  • T to A, chromosome 13 at 52,624,727 bp
  • G to A, chromosome 13 at 113,100,930 bp
  • T to C, chromosome 14 at 50,320,776 bp
  • T to A, chromosome 14 at 57,604,456 bp
  • T to C, chromosome 14 at 121,546,042 bp
  • A to C, chromosome 15 at 23,474,052 bp
  • A to G, chromosome 15 at 78,164,191 bp
  • A to T, chromosome 15 at 99,243,694 bp
  • T to A, chromosome 16 at 45,095,249 bp
  • A to G, chromosome 16 at 59,185,754 bp
  • G to T, chromosome 17 at 34,734,539 bp
  • A to T, chromosome 17 at 87,020,482 bp
  • T to C, chromosome 18 at 62,178,933 bp
  • A to T, chromosome 18 at 80,844,591 bp
  • T to C, chromosome 19 at 25,678,015 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8420 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067773-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.