Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8420Btlr/Mmmh
Stock Number:
067773-MU
Citation ID:
RRID:MMRRC_067773-MU
Other Names:
R8420 (G1)
Major Collection:

Strain Information

Prnp
Name: prion protein
Synonyms: PrP, PrPC, Prn-i, Prn-p, Sinc, PrPSc, CD230
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19122
HGNC: HGNC:9449
Homologene: 7904
Lrrn1
Name: leucine rich repeat protein 1, neuronal
Synonyms: NLRR-1, 2810047E21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16979
Homologene: 32036
Pigf
Name: phosphatidylinositol glycan anchor biosynthesis, class F
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18701
HGNC: HGNC:8962
Homologene: 31103
Dock9
Name: dedicator of cytokinesis 9
Synonyms: B230309H04Rik, D14Wsu89e, Zizimin1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105445
Homologene: 41026
Rtn4
Name: reticulon 4
Synonyms: 1110020G17Rik, C130026I10Rik, NOGO, NgA, Nogo-B, Nogo-A
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68585
Homologene: 10743
Ubr1
Name: ubiquitin protein ligase E3 component n-recognin 1
Synonyms: E3 alpha
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22222
Homologene: 7582
Xpo4
Name: exportin 4
Synonyms: B430309A01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57258
Homologene: 10733
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 24,028,488 bp
  • A to T, chromosome 1 at 93,022,419 bp
  • C to T, chromosome 1 at 189,672,585 bp
  • C to T, chromosome 2 at 76,059,010 bp
  • T to A, chromosome 2 at 86,217,113 bp
  • A to G, chromosome 2 at 120,870,995 bp
  • C to T, chromosome 2 at 129,199,864 bp
  • A to G, chromosome 2 at 131,936,749 bp
  • A to G, chromosome 2 at 144,559,314 bp
  • A to G, chromosome 2 at 165,767,068 bp
  • A to G, chromosome 3 at 61,364,384 bp
  • C to T, chromosome 3 at 151,835,416 bp
  • A to T, chromosome 4 at 113,580,482 bp
  • T to C, chromosome 4 at 149,981,676 bp
  • G to T, chromosome 6 at 15,403,867 bp
  • A to T, chromosome 6 at 42,790,710 bp
  • T to C, chromosome 6 at 57,762,394 bp
  • T to A, chromosome 6 at 107,569,333 bp
  • T to G, chromosome 6 at 111,080,354 bp
  • T to A, chromosome 7 at 17,161,683 bp
  • G to A, chromosome 8 at 10,006,795 bp
  • GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC to GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC, chromosome 8 at 66,860,548 bp
  • A to G, chromosome 8 at 69,611,509 bp
  • T to C, chromosome 9 at 18,537,511 bp
  • A to T, chromosome 9 at 53,375,848 bp
  • A to G, chromosome 9 at 66,794,221 bp
  • A to G, chromosome 9 at 100,553,171 bp
  • T to C, chromosome 10 at 116,112,535 bp
  • A to T, chromosome 11 at 8,870,277 bp
  • A to G, chromosome 11 at 29,707,300 bp
  • A to G, chromosome 11 at 70,978,717 bp
  • A to G, chromosome 11 at 72,257,384 bp
  • A to G, chromosome 11 at 120,046,920 bp
  • A to G, chromosome 12 at 80,475,997 bp
  • A to C, chromosome 12 at 86,988,369 bp
  • C to A, chromosome 13 at 13,437,831 bp
  • T to A, chromosome 13 at 52,624,727 bp
  • G to A, chromosome 13 at 113,100,930 bp
  • T to C, chromosome 14 at 50,320,776 bp
  • T to A, chromosome 14 at 57,604,456 bp
  • T to C, chromosome 14 at 121,546,042 bp
  • A to C, chromosome 15 at 23,474,052 bp
  • A to G, chromosome 15 at 78,164,191 bp
  • A to T, chromosome 15 at 99,243,694 bp
  • T to A, chromosome 16 at 45,095,249 bp
  • A to G, chromosome 16 at 59,185,754 bp
  • G to T, chromosome 17 at 34,734,539 bp
  • A to T, chromosome 17 at 87,020,482 bp
  • T to C, chromosome 18 at 62,178,933 bp
  • A to T, chromosome 18 at 80,844,591 bp
  • T to C, chromosome 19 at 25,678,015 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8420 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067773-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.