Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8438Btlr/Mmmh
Stock Number:
067778-MU
Citation ID:
RRID:MMRRC_067778-MU
Other Names:
R8438 (G1)
Major Collection:

Strain Information

Itpk1
Name: inositol 1,3,4-triphosphate 5/6 kinase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217837
HGNC: HGNC:6177
Homologene: 8588
Aldh1l1
Name: aldehyde dehydrogenase 1 family, member L1
Synonyms: 1810048F20Rik, Fthfd
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107747
HGNC: HGNC:3978
Homologene: 122031
Dgat2
Name: diacylglycerol O-acyltransferase 2
Synonyms: 0610010B06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67800
Homologene: 23580
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Mef2c
Name: myocyte enhancer factor 2C
Synonyms: 9930028G15Rik, 5430401D19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17260
HGNC: HGNC:6996
Homologene: 31087
Thada
Name: thyroid adenoma associated
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240174
VEGA: 17
Homologene: 75175
Top3b
Name: topoisomerase (DNA) III beta
Synonyms: Topo III beta
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21976
Homologene: 2923
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 46,188,679 bp
  • C to A, chromosome 2 at 31,391,076 bp
  • C to A, chromosome 2 at 32,260,141 bp
  • A to G, chromosome 2 at 36,055,064 bp
  • T to C, chromosome 2 at 37,856,138 bp
  • G to T, chromosome 2 at 59,917,484 bp
  • C to T, chromosome 2 at 89,617,710 bp
  • A to T, chromosome 2 at 89,752,717 bp
  • G to A, chromosome 2 at 130,663,382 bp
  • A to T, chromosome 2 at 174,645,003 bp
  • A to G, chromosome 3 at 54,222,253 bp
  • CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC to CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC, chromosome 3 at 93,446,708 bp
  • A to T, chromosome 3 at 95,008,122 bp
  • G to A, chromosome 3 at 108,393,823 bp
  • C to A, chromosome 4 at 141,813,623 bp
  • G to A, chromosome 5 at 8,946,120 bp
  • A to T, chromosome 5 at 48,377,083 bp
  • A to T, chromosome 5 at 124,292,392 bp
  • A to T, chromosome 5 at 137,303,000 bp
  • A to T, chromosome 5 at 146,453,427 bp
  • G to A, chromosome 6 at 4,515,517 bp
  • G to T, chromosome 6 at 4,515,518 bp
  • C to A, chromosome 6 at 32,202,180 bp
  • T to C, chromosome 6 at 47,820,000 bp
  • C to T, chromosome 6 at 55,897,893 bp
  • T to A, chromosome 6 at 58,472,661 bp
  • C to T, chromosome 6 at 90,559,446 bp
  • G to C, chromosome 7 at 15,833,928 bp
  • G to T, chromosome 7 at 19,645,851 bp
  • C to T, chromosome 7 at 28,089,806 bp
  • T to A, chromosome 7 at 55,804,615 bp
  • T to C, chromosome 7 at 99,157,000 bp
  • G to T, chromosome 7 at 125,642,529 bp
  • T to C, chromosome 7 at 126,160,882 bp
  • C to A, chromosome 7 at 126,414,343 bp
  • C to T, chromosome 7 at 139,985,336 bp
  • C to A, chromosome 7 at 140,202,257 bp
  • C to T, chromosome 9 at 15,290,666 bp
  • G to A, chromosome 9 at 108,111,452 bp
  • C to A, chromosome 11 at 4,109,202 bp
  • A to T, chromosome 11 at 58,566,839 bp
  • A to G, chromosome 11 at 96,345,783 bp
  • A to G, chromosome 11 at 110,075,578 bp
  • G to A, chromosome 12 at 102,606,159 bp
  • A to G, chromosome 13 at 83,656,217 bp
  • T to A, chromosome 14 at 20,338,465 bp
  • C to T, chromosome 14 at 20,515,590 bp
  • C to T, chromosome 14 at 27,001,503 bp
  • C to A, chromosome 14 at 70,703,232 bp
  • G to T, chromosome 16 at 16,891,500 bp
  • T to C, chromosome 16 at 23,470,403 bp
  • A to G, chromosome 16 at 59,565,292 bp
  • G to A, chromosome 17 at 84,435,629 bp
  • A to G, chromosome 17 at 84,569,951 bp
  • A to G, chromosome 18 at 37,692,179 bp
  • A to G, chromosome 19 at 40,736,780 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8438 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067778-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.