Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8293Btlr/Mmmh
Stock Number:
067783-MU
Citation ID:
RRID:MMRRC_067783-MU
Other Names:
R8293 (G1)
Major Collection:

Strain Information

Chrm4
Name: cholinergic receptor, muscarinic 4
Synonyms: Chrm-4, muscarinic acetylcholine receptor 4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12672
HGNC: HGNC:1953
Homologene: 20192
Dtnbp1
Name: dystrobrevin binding protein 1
Synonyms: dysbindin, 5430437B18Rik, sdy, Bloc1s8
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 94245
VEGA: 13
Homologene: 12037
Gabarap
Name: gamma-aminobutyric acid receptor associated protein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56486
HGNC: HGNC:4067
Homologene: 134119
Slc12a8
Name: solute carrier family 12 (potassium/chloride transporters), member 8
Synonyms: E330020C02Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 171286
Homologene: 11628
Gcm2
Name: glial cells missing homolog 2
Synonyms: Gcm1-rs2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 107889
VEGA: 13
HGNC: HGNC:4198
Homologene: 3490
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Slc44a2
Name: solute carrier family 44, member 2
Synonyms: 1110028E10Rik, CTL2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68682
VEGA: 9
Homologene: 10711
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 65,108,780 bp
  • G to T, chromosome 1 at 74,803,217 bp
  • A to G, chromosome 1 at 119,981,774 bp
  • A to T, chromosome 2 at 52,246,815 bp
  • T to A, chromosome 2 at 61,644,414 bp
  • T to A, chromosome 2 at 73,570,506 bp
  • C to T, chromosome 2 at 91,928,218 bp
  • A to T, chromosome 2 at 112,156,253 bp
  • T to A, chromosome 2 at 118,761,315 bp
  • T to C, chromosome 2 at 120,862,721 bp
  • A to G, chromosome 4 at 85,033,838 bp
  • T to A, chromosome 4 at 118,809,742 bp
  • A to G, chromosome 4 at 138,804,606 bp
  • A to C, chromosome 5 at 24,487,885 bp
  • A to T, chromosome 5 at 43,688,228 bp
  • A to G, chromosome 5 at 63,805,320 bp
  • A to T, chromosome 5 at 90,904,229 bp
  • A to C, chromosome 5 at 105,224,369 bp
  • A to G, chromosome 5 at 110,708,892 bp
  • A to T, chromosome 5 at 138,230,542 bp
  • C to T, chromosome 7 at 3,640,918 bp
  • A to T, chromosome 7 at 101,400,934 bp
  • A to T, chromosome 7 at 108,081,062 bp
  • T to G, chromosome 7 at 119,638,096 bp
  • T to C, chromosome 7 at 127,972,577 bp
  • A to T, chromosome 8 at 48,367,422 bp
  • A to C, chromosome 8 at 104,832,626 bp
  • A to G, chromosome 8 at 105,297,819 bp
  • A to G, chromosome 9 at 21,353,688 bp
  • A to G, chromosome 9 at 39,184,393 bp
  • G to A, chromosome 9 at 53,816,940 bp
  • A to G, chromosome 10 at 17,902,263 bp
  • C to T, chromosome 10 at 24,101,117 bp
  • T to C, chromosome 10 at 52,087,918 bp
  • T to C, chromosome 10 at 87,226,002 bp
  • A to G, chromosome 10 at 127,191,013 bp
  • C to A, chromosome 10 at 127,666,397 bp
  • T to A, chromosome 11 at 50,095,796 bp
  • C to A, chromosome 11 at 69,992,672 bp
  • T to A, chromosome 12 at 81,420,411 bp
  • A to G, chromosome 13 at 41,103,170 bp
  • G to A, chromosome 13 at 44,931,139 bp
  • A to G, chromosome 13 at 54,526,546 bp
  • A to G, chromosome 13 at 61,254,068 bp
  • T to C, chromosome 13 at 97,942,521 bp
  • T to C, chromosome 14 at 32,974,261 bp
  • T to A, chromosome 14 at 61,191,099 bp
  • ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT to ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT, chromosome 15 at 76,002,775 bp
  • A to T, chromosome 16 at 33,540,978 bp
  • T to C, chromosome 16 at 36,970,025 bp
  • A to G, chromosome 16 at 44,789,721 bp
  • A to C, chromosome 17 at 13,226,904 bp
  • T to C, chromosome 17 at 28,902,890 bp
  • A to G, chromosome 18 at 42,560,955 bp
  • C to A, chromosome 18 at 46,850,565 bp
  • T to C, chromosome 19 at 7,034,250 bp
  • G to A, chromosome 19 at 9,875,133 bp
  • A to T, chromosome 19 at 10,252,037 bp
  • T to A, chromosome 19 at 11,478,296 bp
  • A to T, chromosome 19 at 16,668,605 bp
  • G to T, chromosome 19 at 39,563,967 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8293 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067783-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.