Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8354Btlr/Mmmh
Stock Number:
067806-MU
Citation ID:
RRID:MMRRC_067806-MU
Other Names:
R8354 (G1)
Major Collection:

Strain Information

Ptprz1
Name: protein tyrosine phosphatase receptor type Z, polypeptide 1
Synonyms: DSD-1-PG, phosphacan, PTPzeta, PTPbeta, Rptpbeta, Ptpz, Ptprz, RPTPz
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19283
HGNC: HGNC:9685
Homologene: 2136
Itgb8
Name: integrin beta 8
Synonyms: 4832412O06Rik, D630049N15
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320910
HGNC: HGNC:6163
Homologene: 18567
Met
Name: met proto-oncogene, receptor tyrosine kinase
Synonyms: HGF receptor, c-Met, Par4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17295
HGNC: HGNC:7029
Homologene: 206
Agt
Name: angiotensinogen
Synonyms: Aogen, Serpina8, angiotensin precursor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11606
HGNC: HGNC:333
Homologene: 14
Ncam2
Name: neural cell adhesion molecule 2
Synonyms: RNCAM, R4B12 antigen, Ncam-2, Ocam
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Prrc1
Name: proline-rich coiled-coil 1
Synonyms: 2310058D16Rik, 9430085A19Rik, 3110038B19Rik, 1190002C06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 73137
VEGA: 18
Homologene: 12491
Slc4a7
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 7
Synonyms: E430014N10Rik, NBC3, NBCn1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218756
VEGA: 14
Homologene: 2680
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 43,075,910 bp
  • A to G, chromosome 1 at 53,925,308 bp
  • C to A, chromosome 1 at 59,130,065 bp
  • A to T, chromosome 1 at 87,980,972 bp
  • A to T, chromosome 1 at 135,959,881 bp
  • A to T, chromosome 1 at 150,758,391 bp
  • A to G, chromosome 1 at 154,398,568 bp
  • A to T, chromosome 1 at 166,108,133 bp
  • T to C, chromosome 1 at 170,682,224 bp
  • G to A, chromosome 1 at 180,333,343 bp
  • T to C, chromosome 2 at 88,274,692 bp
  • T to C, chromosome 2 at 90,469,717 bp
  • T to A, chromosome 2 at 129,066,184 bp
  • A to T, chromosome 2 at 150,834,377 bp
  • C to A, chromosome 2 at 153,393,425 bp
  • T to A, chromosome 2 at 156,781,128 bp
  • T to C, chromosome 3 at 72,947,501 bp
  • T to C, chromosome 3 at 73,049,180 bp
  • T to C, chromosome 3 at 75,895,001 bp
  • C to A, chromosome 3 at 86,107,022 bp
  • T to A, chromosome 3 at 104,004,449 bp
  • T to C, chromosome 3 at 127,812,779 bp
  • T to C, chromosome 3 at 146,097,227 bp
  • T to A, chromosome 3 at 146,646,402 bp
  • T to A, chromosome 4 at 42,793,223 bp
  • T to C, chromosome 4 at 59,913,931 bp
  • A to T, chromosome 4 at 94,569,477 bp
  • T to A, chromosome 4 at 133,848,553 bp
  • A to T, chromosome 4 at 145,287,983 bp
  • A to G, chromosome 4 at 146,466,862 bp
  • T to A, chromosome 4 at 154,926,655 bp
  • T to A, chromosome 5 at 3,631,707 bp
  • T to C, chromosome 5 at 4,757,336 bp
  • T to A, chromosome 5 at 24,869,139 bp
  • T to C, chromosome 5 at 36,065,409 bp
  • T to G, chromosome 5 at 105,094,161 bp
  • A to G, chromosome 5 at 117,995,414 bp
  • T to C, chromosome 5 at 123,778,267 bp
  • T to A, chromosome 5 at 128,994,868 bp
  • ACCCAGCACCTGGAGATCGTCC to ACC, chromosome 5 at 139,161,859 bp
  • T to C, chromosome 5 at 139,971,471 bp
  • GCACATCAGGATCC to GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC, chromosome 6 at 4,756,452 bp
  • A to G, chromosome 6 at 17,491,769 bp
  • A to G, chromosome 6 at 22,999,615 bp
  • G to A, chromosome 6 at 29,920,532 bp
  • A to T, chromosome 6 at 30,489,309 bp
  • A to G, chromosome 6 at 69,243,276 bp
  • A to G, chromosome 6 at 72,370,393 bp
  • A to G, chromosome 6 at 114,480,853 bp
  • T to C, chromosome 6 at 120,973,420 bp
  • A to T, chromosome 6 at 124,328,965 bp
  • A to T, chromosome 6 at 132,755,447 bp
  • C to A, chromosome 7 at 29,015,717 bp
  • A to C, chromosome 7 at 45,007,827 bp
  • T to A, chromosome 7 at 84,940,194 bp
  • A to T, chromosome 7 at 108,346,682 bp
  • G to A, chromosome 7 at 109,525,548 bp
  • T to A, chromosome 7 at 118,792,572 bp
  • T to A, chromosome 7 at 120,831,180 bp
  • T to C, chromosome 7 at 129,602,999 bp
  • C to T, chromosome 7 at 139,653,498 bp
  • T to C, chromosome 7 at 141,458,098 bp
  • T to A, chromosome 8 at 56,125,310 bp
  • C to A, chromosome 8 at 70,071,597 bp
  • A to G, chromosome 8 at 72,741,480 bp
  • T to C, chromosome 8 at 84,965,147 bp
  • C to T, chromosome 8 at 95,638,018 bp
  • A to G, chromosome 8 at 104,241,114 bp
  • G to A, chromosome 8 at 124,564,103 bp
  • T to C, chromosome 8 at 125,761,618 bp
  • T to C, chromosome 9 at 14,463,939 bp
  • C to A, chromosome 9 at 26,806,417 bp
  • C to G, chromosome 9 at 26,883,280 bp
  • T to A, chromosome 9 at 26,883,281 bp
  • T to C, chromosome 9 at 38,269,217 bp
  • A to G, chromosome 9 at 49,107,139 bp
  • T to A, chromosome 9 at 53,566,951 bp
  • T to C, chromosome 9 at 72,619,449 bp
  • T to C, chromosome 9 at 77,031,695 bp
  • A to G, chromosome 9 at 104,217,728 bp
  • G to A, chromosome 9 at 107,524,135 bp
  • A to G, chromosome 9 at 121,695,655 bp
  • G to A, chromosome 10 at 75,048,459 bp
  • A to G, chromosome 10 at 77,776,610 bp
  • A to T, chromosome 10 at 77,933,649 bp
  • A to T, chromosome 10 at 79,148,876 bp
  • A to G, chromosome 10 at 80,525,799 bp
  • A to G, chromosome 10 at 80,887,486 bp
  • G to T, chromosome 11 at 62,836,761 bp
  • A to G, chromosome 11 at 69,909,236 bp
  • A to G, chromosome 11 at 73,291,622 bp
  • A to G, chromosome 11 at 99,389,260 bp
  • T to C, chromosome 11 at 100,336,568 bp
  • T to A, chromosome 11 at 118,398,541 bp
  • A to G, chromosome 12 at 31,075,179 bp
  • A to T, chromosome 12 at 114,879,940 bp
  • A to T, chromosome 12 at 119,170,778 bp
  • A to G, chromosome 13 at 9,621,882 bp
  • C to A, chromosome 13 at 23,464,250 bp
  • T to A, chromosome 13 at 29,985,804 bp
  • C to T, chromosome 14 at 14,786,313 bp
  • T to A, chromosome 14 at 55,755,141 bp
  • C to A, chromosome 14 at 110,752,046 bp
  • T to C, chromosome 14 at 116,925,979 bp
  • T to C, chromosome 15 at 34,378,697 bp
  • C to T, chromosome 15 at 34,876,724 bp
  • A to G, chromosome 15 at 92,232,249 bp
  • A to G, chromosome 15 at 98,912,476 bp
  • A to G, chromosome 15 at 99,229,330 bp
  • T to C, chromosome 15 at 101,541,803 bp
  • T to C, chromosome 16 at 15,581,141 bp
  • A to G, chromosome 16 at 18,777,293 bp
  • T to A, chromosome 16 at 21,947,431 bp
  • T to C, chromosome 16 at 56,034,507 bp
  • C to G, chromosome 16 at 56,795,682 bp
  • A to G, chromosome 16 at 81,512,959 bp
  • G to T, chromosome 16 at 91,683,797 bp
  • T to A, chromosome 17 at 17,088,199 bp
  • C to A, chromosome 17 at 24,857,562 bp
  • G to A, chromosome 17 at 27,115,919 bp
  • A to T, chromosome 17 at 30,643,260 bp
  • A to G, chromosome 17 at 35,031,766 bp
  • C to A, chromosome 17 at 46,324,177 bp
  • C to G, chromosome 17 at 71,697,878 bp
  • C to A, chromosome 18 at 35,252,723 bp
  • A to T, chromosome 18 at 37,768,137 bp
  • T to A, chromosome 18 at 57,371,431 bp
  • A to T, chromosome 18 at 78,857,383 bp
  • A to G, chromosome 19 at 8,934,994 bp
  • A to T, chromosome 19 at 44,998,427 bp
  • T to A, chromosome 19 at 56,312,956 bp
  • G to A, chromosome Y at 1,157,928 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8354 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067806-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.