Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8408Btlr/Mmmh
Stock Number:
067815-MU
Citation ID:
RRID:MMRRC_067815-MU
Other Names:
R8408 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
Zic1
Name: zinc finger protein of the cerebellum 1
Synonyms: odd-paired homolog
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22771
Homologene: 2562
Dlg4
Name: discs large MAGUK scaffold protein 4
Synonyms: SAP90, PSD-95, SAP90A, PSD95, Dlgh4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13385
HGNC: HGNC:2903
Homologene: 1047
Nup205
Name: nucleoporin 205
Synonyms: 3830404O05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70699
Homologene: 45971
Dnttip2
Name: deoxynucleotidyltransferase, terminal, interacting protein 2
Synonyms: 4930588M11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99480
Homologene: 124162
Crygb
Name: crystallin, gamma B
Synonyms: DGcry-3, Cryg-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12965
HGNC: HGNC:2409
Homologene: 3816
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 15,711,553 bp
  • A to T, chromosome 1 at 54,723,098 bp
  • A to T, chromosome 1 at 57,409,943 bp
  • T to G, chromosome 1 at 65,080,550 bp
  • T to A, chromosome 1 at 153,825,689 bp
  • T to C, chromosome 1 at 171,252,745 bp
  • T to C, chromosome 2 at 52,157,911 bp
  • T to A, chromosome 2 at 76,714,466 bp
  • CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC to CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC, chromosome 3 at 92,317,519 bp
  • A to G, chromosome 3 at 122,276,702 bp
  • T to C, chromosome 4 at 103,189,810 bp
  • T to A, chromosome 4 at 125,044,289 bp
  • A to G, chromosome 4 at 143,965,642 bp
  • A to G, chromosome 5 at 135,168,454 bp
  • A to T, chromosome 5 at 142,705,354 bp
  • C to CTCA, chromosome 6 at 4,756,453 bp
  • A to G, chromosome 6 at 35,225,247 bp
  • G to A, chromosome 6 at 98,945,582 bp
  • C to T, chromosome 7 at 119,952,505 bp
  • G to A, chromosome 7 at 141,431,824 bp
  • G to A, chromosome 8 at 22,862,259 bp
  • A to G, chromosome 8 at 84,212,385 bp
  • G to A, chromosome 9 at 35,685,122 bp
  • G to T, chromosome 9 at 91,364,794 bp
  • T to C, chromosome 9 at 108,831,789 bp
  • T to G, chromosome 10 at 12,670,143 bp
  • A to G, chromosome 10 at 13,253,826 bp
  • A to T, chromosome 11 at 48,948,002 bp
  • A to T, chromosome 11 at 69,109,127 bp
  • T to A, chromosome 11 at 70,042,252 bp
  • T to A, chromosome 11 at 73,425,968 bp
  • C to T, chromosome 11 at 80,223,960 bp
  • T to C, chromosome 11 at 97,031,043 bp
  • T to A, chromosome 11 at 103,460,809 bp
  • A to G, chromosome 12 at 69,169,051 bp
  • A to G, chromosome 12 at 71,189,582 bp
  • A to G, chromosome 14 at 26,915,110 bp
  • A to G, chromosome 14 at 121,478,116 bp
  • G to C, chromosome 16 at 13,130,137 bp
  • T to C, chromosome 16 at 17,925,856 bp
  • A to T, chromosome 16 at 32,955,380 bp
  • T to C, chromosome 16 at 44,384,697 bp
  • A to T, chromosome 16 at 59,304,055 bp
  • C to A, chromosome 18 at 4,649,402 bp
  • A to G, chromosome 18 at 24,267,571 bp
  • T to C, chromosome 18 at 47,248,891 bp
  • T to A, chromosome 18 at 84,631,924 bp
  • T to C, chromosome 19 at 10,723,105 bp
  • T to G, chromosome 19 at 17,433,445 bp
  • T to C, chromosome 19 at 55,189,667 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8408 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067815-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.