Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8408Btlr/Mmmh
Stock Number:
067815-MU
Citation ID:
RRID:MMRRC_067815-MU
Other Names:
R8408 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
Zic1
Name: zinc finger protein of the cerebellum 1
Synonyms: odd-paired homolog
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22771
Homologene: 2562
Dlg4
Name: discs large MAGUK scaffold protein 4
Synonyms: SAP90, PSD-95, SAP90A, PSD95, Dlgh4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13385
HGNC: HGNC:2903
Homologene: 1047
Nup205
Name: nucleoporin 205
Synonyms: 3830404O05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70699
Homologene: 45971
Dnttip2
Name: deoxynucleotidyltransferase, terminal, interacting protein 2
Synonyms: 4930588M11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99480
Homologene: 124162
Crygb
Name: crystallin, gamma B
Synonyms: DGcry-3, Cryg-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12965
HGNC: HGNC:2409
Homologene: 3816
Jcad
Name: junctional cadherin 5 associated
Synonyms: 9430020K01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240185
VEGA: 18
Homologene: 19370
Rhot1
Name: ras homolog family member T1
Synonyms: Miro1, 2210403N23Rik, FLJ11040, Arht1, C430039G08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 59040
Homologene: 56803
Sema6a
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A
Synonyms: VIa, sema, Sema6A-1, Semaq, A730020P05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20358
Homologene: 32426
Cndp1
Name: carnosine dipeptidase 1
Synonyms: Cn1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 338403
Homologene: 57178
Per1
Name: period circadian clock 1
Synonyms: m-rigui, mPer1, Hftm
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18626
HGNC: HGNC:8845
Homologene: 1966
Bcl7b
Name: B cell CLL/lymphoma 7B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12054
HGNC: HGNC:1005
Homologene: 1290
Lrch3
Name: leucine-rich repeats and calponin homology (CH) domain containing 3
Synonyms: LOC385628, 2210409B11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70144
Homologene: 13111
2700049A03Rik
Name: RIKEN cDNA 2700049A03 gene
Synonyms: talpid3, Ta3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76967
Homologene: 8839
Gnl2
Name: guanine nucleotide binding protein nucleolar 2
Synonyms: Ngp-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230737
Homologene: 6858
Kat6a
Name: K(lysine) acetyltransferase 6A
Synonyms: MOZ, Zfp220, 9930021N24Rik, Myst3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244349
Homologene: 4924
Zswim4
Name: zinc finger SWIM-type containing 4
Synonyms: E130119J17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212168
Homologene: 18183
Slc25a22
Name: solute carrier family 25 (mitochondrial carrier, glutamate), member 22
Synonyms: 1300006L01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68267
Homologene: 69383
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Slc35d1
Name: solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1
Synonyms: UGTREL7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242585
Homologene: 22870
Adamts4
Name: ADAM metallopeptidase with thrombospondin type 1 motif 4
Synonyms: aggrecanase-1, ADAM-TS4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240913
HGNC: HGNC:220
Homologene: 36169
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Lrrc37a
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237954
Homologene: 138824
Pcsk5
Name: proprotein convertase subtilisin/kexin type 5
Synonyms: PC6, SPC6, PC5A, PC5/6A, b2b585Clo, b2b1549Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18552
VEGA: 19
HGNC: HGNC:8747
Homologene: 21244
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Celsr3
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: Fmi1, flamingo, Adgrc3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 107934
HGNC: HGNC:3230
Homologene: 1077
Tectb
Name: tectorin beta
Synonyms: [b]-tectorin, Tctnb
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21684
Homologene: 7568
Slc29a4
Name: solute carrier family 29 (nucleoside transporters), member 4
Synonyms: ENT4, mPMAT
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243328
Homologene: 71345
Rgsl1
Name: regulator of G-protein signaling like 1
Synonyms: 4930415K13Rik, Rgsl2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240816
Homologene: 129962
Ercc4
Name: excision repair cross-complementing rodent repair deficiency, complementation group 4
Synonyms: Xpf
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 50505
HGNC: HGNC:3436
Homologene: 3836
Spice1
Name: spindle and centriole associated protein 1
Synonyms: D16Ertd480e, Ccdc52
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 212514
Homologene: 16931
Galnt1
Name: polypeptide N-acetylgalactosaminyltransferase 1
Synonyms: ppGaNTase-T1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14423
HGNC: HGNC:4123
Homologene: 8469
Kcnb2
Name: potassium voltage gated channel, Shab-related subfamily, member 2
Synonyms: Kv2.2, 9630047L19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98741
HGNC: HGNC:6232
Homologene: 31263
Maip1
Name: matrix AAA peptidase interacting protein 1
Synonyms: 9430016H08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68115
Homologene: 11565
Ankrd44
Name: ankyrin repeat domain 44
Synonyms: E130014H08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329154
Homologene: 27547
Or1e19
Name: olfactory receptor family 1 subfamily E member 19
Synonyms: GA_x6K02T2P1NL-3586282-3585338, MOR135-2, Olfr378
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259026
Homologene: 74110
9930111J21Rik1
Name: RIKEN cDNA 9930111J21 gene 1
Synonyms: 9930111J21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 667214
Homologene: 83188
Scrn2
Name: secernin 2
Synonyms: SES2, D11Moh48
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217140
Homologene: 26698
Lrr1
Name: leucine rich repeat protein 1
Synonyms: 2410005L11Rik, LRR-1, Ppil5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 69706
VEGA: 12
Homologene: 32677
Cd5
Name: CD5 antigen
Synonyms: Ly-A, Lyt-1, Ly-12, Ly-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12507
VEGA: 19
HGNC: HGNC:1685
Homologene: 7260
Or5ac21
Name: olfactory receptor family 5 subfamily AC member 21
Synonyms: GA_x54KRFPKG5P-55517445-55518365, MOR182-5, Olfr203
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258479
Homologene: 122781
Asb14
Name: ankyrin repeat and SOCS box-containing 14
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 142687
Homologene: 15445
Pate1
Name: prostate and testis expressed 1
Synonyms: Gm17252
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100312987
Homologene: 89136
Slc15a1
Name: solute carrier family 15 (oligopeptide transporter), member 1
Synonyms: PECT1, PEPT1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56643
VEGA: 14
Homologene: 38006
Slc25a1
Name: solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1
Synonyms: Dgsj, Slc20a3, 2610100G11Rik, 1300019P08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13358
Homologene: 4362
Sprr2b
Name: small proline-rich protein 2B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20756
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 15,711,553 bp
  • A to T, chromosome 1 at 54,723,098 bp
  • A to T, chromosome 1 at 57,409,943 bp
  • T to G, chromosome 1 at 65,080,550 bp
  • T to A, chromosome 1 at 153,825,689 bp
  • T to C, chromosome 1 at 171,252,745 bp
  • T to C, chromosome 2 at 52,157,911 bp
  • T to A, chromosome 2 at 76,714,466 bp
  • CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC to CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC, chromosome 3 at 92,317,519 bp
  • A to G, chromosome 3 at 122,276,702 bp
  • T to C, chromosome 4 at 103,189,810 bp
  • T to A, chromosome 4 at 125,044,289 bp
  • A to G, chromosome 4 at 143,965,642 bp
  • A to G, chromosome 5 at 135,168,454 bp
  • A to T, chromosome 5 at 142,705,354 bp
  • C to CTCA, chromosome 6 at 4,756,453 bp
  • A to G, chromosome 6 at 35,225,247 bp
  • G to A, chromosome 6 at 98,945,582 bp
  • C to T, chromosome 7 at 119,952,505 bp
  • G to A, chromosome 7 at 141,431,824 bp
  • G to A, chromosome 8 at 22,862,259 bp
  • A to G, chromosome 8 at 84,212,385 bp
  • G to A, chromosome 9 at 35,685,122 bp
  • G to T, chromosome 9 at 91,364,794 bp
  • T to C, chromosome 9 at 108,831,789 bp
  • T to G, chromosome 10 at 12,670,143 bp
  • A to G, chromosome 10 at 13,253,826 bp
  • A to T, chromosome 11 at 48,948,002 bp
  • A to T, chromosome 11 at 69,109,127 bp
  • T to A, chromosome 11 at 70,042,252 bp
  • T to A, chromosome 11 at 73,425,968 bp
  • C to T, chromosome 11 at 80,223,960 bp
  • T to C, chromosome 11 at 97,031,043 bp
  • T to A, chromosome 11 at 103,460,809 bp
  • A to G, chromosome 12 at 69,169,051 bp
  • A to G, chromosome 12 at 71,189,582 bp
  • A to G, chromosome 14 at 26,915,110 bp
  • A to G, chromosome 14 at 121,478,116 bp
  • G to C, chromosome 16 at 13,130,137 bp
  • T to C, chromosome 16 at 17,925,856 bp
  • A to T, chromosome 16 at 32,955,380 bp
  • T to C, chromosome 16 at 44,384,697 bp
  • A to T, chromosome 16 at 59,304,055 bp
  • C to A, chromosome 18 at 4,649,402 bp
  • A to G, chromosome 18 at 24,267,571 bp
  • T to C, chromosome 18 at 47,248,891 bp
  • T to A, chromosome 18 at 84,631,924 bp
  • T to C, chromosome 19 at 10,723,105 bp
  • T to G, chromosome 19 at 17,433,445 bp
  • T to C, chromosome 19 at 55,189,667 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8408 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067815-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.