Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8426Btlr/Mmmh
Stock Number:
067820-MU
Citation ID:
RRID:MMRRC_067820-MU
Other Names:
R8426 (G1)
Major Collection:

Strain Information

Myo10
Name: myosin X
Synonyms: myosin-X, D15Ertd600e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17909
HGNC: HGNC:7593
Homologene: 36328
Kif5a
Name: kinesin family member 5A
Synonyms: Kns, Kif5, D10Bwg0738e, Khc
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16572
VEGA: 10
HGNC: HGNC:6323
Homologene: 55861
Ptch2
Name: patched 2
Synonyms: ptc2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19207
HGNC: HGNC:9586
Homologene: 37842
Iffo2
Name: intermediate filament family orphan 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212632
Homologene: 102202
Tm9sf4
Name: transmembrane 9 superfamily member 4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99237
Homologene: 21620
Ipo11
Name: importin 11
Synonyms: E330021B14Rik, 1700081H05Rik, 2510001A17Rik, Ranbp11
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76582
Homologene: 7089
Thada
Name: thyroid adenoma associated
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240174
VEGA: 17
Homologene: 75175
Smchd1
Name: SMC hinge domain containing 1
Synonyms: 4931400A14Rik, MommeD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74355
Homologene: 23665
Ints4
Name: integrator complex subunit 4
Synonyms: 2610034N24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101861
Homologene: 69427
Nol6
Name: nucleolar protein family 6 (RNA-associated)
Synonyms: Nrap
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230082
Homologene: 41505
Casp9
Name: caspase 9
Synonyms: Mch6, ICE-LAP6, Caspase-9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12371
HGNC: HGNC:1511
Homologene: 31024
Slit2
Name: slit guidance ligand 2
Synonyms: Slil3, Drad-1, E130320P19Rik, E030015M03Rik, b2b1200.1Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20563
Homologene: 3516
Lepr
Name: leptin receptor
Synonyms: Obr, leptin receptor gene-related protein, OB-RGRP, LEPROT, obl, obese-like, Modb1, Leprb
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16847
HGNC: HGNC:6554
Homologene: 1731
Phf24
Name: PHD finger protein 24
Synonyms: N28178, GINIP
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230085
Homologene: 18208
Elapor1
Name: endosome-lysosome associated apoptosis and autophagy regulator 1
Synonyms: 5330417C22Rik, Inceptor, Iir
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229722
Homologene: 23249
Tcerg1
Name: transcription elongation regulator 1 (CA150)
Synonyms: p144, ca150, Taf2s, 2410022J09Rik, 2900090C16Rik, Fbp28
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 56070
Homologene: 4879
Thsd1
Name: thrombospondin, type I, domain 1
Synonyms: 4833423O18Rik, Tmtsp
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56229
Homologene: 10264
Mov10l1
Name: Mov10 like RISC complex RNA helicase 1
Synonyms: CHAMP, Csm
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 83456
HGNC: HGNC:7201
Homologene: 56835
Gnao1
Name: guanine nucleotide binding protein, alpha O
Synonyms: Go alpha, alphaO, Galphao
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14681
HGNC: HGNC:4389
Homologene: 39203
Lama4
Name: laminin, alpha 4
Synonyms: laminin [a]4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16775
HGNC: HGNC:6484
Homologene: 37604
Or10aa3
Name: olfactory receptor family 10 subfamily AA member 3
Synonyms: GA_x6K02T2P20D-21124681-21123743, MOR123-2, Olfr432
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258711
Homologene: 81532
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Abcb11
Name: ATP-binding cassette, sub-family B member 11
Synonyms: PFIC2, ABC16, PGY4, Lith1, sister of P-glycoprotein, Bsep
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Abcb1b
Name: ATP-binding cassette, sub-family B member 1B
Synonyms: Mdr1, Mdr1b, mdr, Pgy1, Pgy-1, Abcb1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18669
HGNC: HGNC:40
Homologene: 69084
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Unc5d
Name: unc-5 netrin receptor D
Synonyms: Unc5h4, D930029E11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 210801
Homologene: 15450
Neu2
Name: neuraminidase 2
Synonyms: brain sialidase, cystolic sialidase, MSS, MBS, MTS
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23956
HGNC: HGNC:7759
Homologene: 3927
Or8b46
Name: olfactory receptor family 8 subfamily B member 46
Synonyms: GA_x6K02T2PVTD-32239063-32239995, MOR165-3, Olfr910
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258807
VEGA: 9
Homologene: 115510
Nrxn3
Name: neurexin III
Synonyms: neurexin III beta, neurexin III alpha, neurexin III beta, neurexin III alpha, 9330112C09Rik, D12Bwg0831e, 4933401A11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18191
HGNC: HGNC:8010
Homologene: 83225
Ogn
Name: osteoglycin
Synonyms: OG, 3110079A16Rik, mimican, SLRR3A, mimecan
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18295
VEGA: 13
HGNC: HGNC:8126
Homologene: 8542
Vmn1r68
Name: vomeronasal 1 receptor 68
Synonyms: Gm6898
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 628580
Homologene: 120153
Ttc28
Name: tetratricopeptide repeat domain 28
Synonyms: 2310015L07Rik, TPRBK
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 209683
Homologene: 41023
Tmprss11c
Name: transmembrane protease, serine 11c
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 435845
Homologene: 78847
Sart1
Name: squamous cell carcinoma antigen recognized by T cells 1
Synonyms: U5-110K
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20227
VEGA: 19
Homologene: 133770
Vmn2r107
Name: vomeronasal 2, receptor 107
Synonyms: V2r6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22312
Homologene: 129750
Plscr4
Name: phospholipid scramblase 4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235527
Homologene: 23217
Cxcr6
Name: C-X-C motif chemokine receptor 6
Synonyms: STRL33, BONZO
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 80901
VEGA: 9
Homologene: 38197
Ceacam5
Name: CEA cell adhesion molecule 5
Synonyms: 1600029H12Rik, Psg30
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73250
Homologene: 115938
Plat
Name: plasminogen activator, tissue
Synonyms: t-PA, tPA, D8Ertd2e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18791
HGNC: HGNC:9051
Homologene: 717
Aicda
Name: activation-induced cytidine deaminase
Synonyms: Aid
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11628
Homologene: 7623
Vmn1r44
Name: vomeronasal 1 receptor 44
Synonyms: V1rb4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113854
Homologene: 113975
Catsper2
Name: cation channel, sperm associated 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 212670
Homologene: 77423
Gm17728
Name: predicted gene, 17728
Type: Gene
Species: Mouse
Chromosome: 17
Mroh9
Name: maestro heat-like repeat family member 9
Synonyms: Armc11, 4921528O07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78258
Homologene: 123521
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 87,596,665 bp
  • A to T, chromosome 1 at 163,024,725 bp
  • T to C, chromosome 1 at 174,050,580 bp
  • T to C, chromosome 2 at 41,498,306 bp
  • T to C, chromosome 2 at 69,325,262 bp
  • TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT to TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT, chromosome 2 at 121,397,572 bp
  • G to A, chromosome 2 at 153,203,816 bp
  • G to A, chromosome 3 at 108,471,426 bp
  • T to C, chromosome 4 at 41,119,870 bp
  • C to T, chromosome 4 at 42,933,785 bp
  • G to A, chromosome 4 at 101,814,644 bp
  • G to T, chromosome 4 at 117,108,172 bp
  • A to T, chromosome 4 at 139,614,980 bp
  • T to C, chromosome 4 at 141,813,625 bp
  • T to C, chromosome 5 at 8,861,632 bp
  • A to G, chromosome 5 at 48,224,763 bp
  • G to T, chromosome 5 at 86,231,818 bp
  • G to A, chromosome 5 at 111,233,341 bp
  • A to G, chromosome 6 at 89,893,488 bp
  • A to T, chromosome 6 at 122,561,191 bp
  • T to C, chromosome 7 at 10,527,455 bp
  • T to C, chromosome 7 at 17,759,341 bp
  • G to A, chromosome 7 at 97,501,032 bp
  • A to G, chromosome 8 at 22,243,638 bp
  • G to T, chromosome 8 at 22,772,232 bp
  • G to T, chromosome 8 at 28,719,988 bp
  • A to T, chromosome 8 at 93,896,229 bp
  • A to T, chromosome 9 at 38,539,324 bp
  • C to T, chromosome 9 at 92,490,790 bp
  • T to C, chromosome 9 at 108,126,573 bp
  • A to G, chromosome 9 at 123,810,006 bp
  • A to G, chromosome 10 at 39,103,491 bp
  • T to C, chromosome 10 at 127,231,489 bp
  • G to A, chromosome 12 at 88,795,327 bp
  • C to T, chromosome 13 at 49,621,091 bp
  • T to C, chromosome 13 at 106,842,170 bp
  • A to G, chromosome 15 at 25,799,490 bp
  • T to A, chromosome 15 at 88,997,405 bp
  • A to G, chromosome 17 at 9,422,399 bp
  • T to A, chromosome 17 at 20,356,977 bp
  • A to C, chromosome 17 at 71,448,603 bp
  • A to T, chromosome 17 at 84,222,703 bp
  • G to A, chromosome 18 at 42,548,401 bp
  • A to G, chromosome 19 at 5,383,741 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8426 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067820-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.