Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8456Btlr/Mmmh
Stock Number:
067833-MU
Citation ID:
RRID:MMRRC_067833-MU
Other Names:
R8456 (G1)
Major Collection:

Strain Information

Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: LOC381367, Nav1.3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20269
Homologene: 56005
Tal1
Name: T cell acute lymphocytic leukemia 1
Synonyms: SCL/tal-1, Scl, bHLHa17, Hpt
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21349
Homologene: 2400
Exoc6b
Name: exocyst complex component 6B
Synonyms: 4930569O18Rik, G430127E12Rik, Sec15b, Sec15l2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75914
Homologene: 44781
Ranbp1
Name: RAN binding protein 1
Synonyms: Htf9a
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19385
HGNC: HGNC:9847
Homologene: 21600
Camsap3
Name: calmodulin regulated spectrin-associated protein family, member 3
Synonyms: Nezha, 2310057J16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69697
Homologene: 18966
Zbtb32
Name: zinc finger and BTB domain containing 32
Synonyms: Tzfp, 4930524C15Rik, PLZP, Rog
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 58206
Homologene: 8661
Rev1
Name: REV1, DNA directed polymerase
Synonyms: REV1, 1110027I23Rik, Rev1l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56210
Homologene: 32309
Vps35
Name: VPS35 retromer complex component
Synonyms: Mem3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 65114
Homologene: 6221
Bltp3b
Name: bridge-like lipid transfer protein family member 3B
Synonyms: 4930506D01Rik, 2010319N22Rik, E030041M21Rik, Uhrf1bp1l
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75089
VEGA: 10
Homologene: 12590
Nup214
Name: nucleoporin 214
Synonyms: D2H9S46E, CAN
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227720
HGNC: HGNC:8064
Homologene: 38008
Akap1
Name: A kinase anchor protein 1
Synonyms: S-AKAP84, AKAP84, AKAP121, DAKAP1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11640
HGNC: HGNC:367
Homologene: 31165
Elp1
Name: elongator complex protein 1
Synonyms: 3110040G09Rik, C78473, IKAP, Ikbkap
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230233
HGNC: HGNC:5959
Homologene: 2699
Ereg
Name: epiregulin
Synonyms: EPR
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13874
HGNC: HGNC:3443
Homologene: 1097
Naa16
Name: N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Synonyms: 1300019C06Rik, Narg1l
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66897
Homologene: 134838
Ccser2
Name: coiled-coil serine rich 2
Synonyms: 1700012P13Rik, 2900054P12Rik, Gcap14
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72972
Homologene: 10367
Melk
Name: maternal embryonic leucine zipper kinase
Synonyms: MPK38
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17279
Homologene: 32111
Zdhhc13
Name: zinc finger, DHHC domain containing 13
Synonyms: kojak, 2410004E01Rik, Hip14l, skc4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243983
Homologene: 75106
Ebf3
Name: early B cell factor 3
Synonyms: O/E-2, Olf-1/EBF-like 2, 3110018A08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13593
Homologene: 56472
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Asph
Name: aspartate-beta-hydroxylase
Synonyms: cI-37, 2310005F16Rik, aspartyl beta-hydroxylase, calsequestrin-binding protein, Junctin, jumbug, BAH, 3110001L23Rik, junctate
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 65973
HGNC: HGNC:757
Homologene: 20910
Dtwd1
Name: DTW domain containing 1
Synonyms: 1810033A06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69185
Homologene: 10633
Pom121
Name: nuclear pore membrane protein 121
Synonyms: 2610027A18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 107939
Homologene: 70878
Rnf157
Name: ring finger protein 157
Synonyms: A130073L17Rik, 2610036E23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217340
Homologene: 28235
Wdr95
Name: WD40 repeat domain 95
Synonyms: 4930434E21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381693
Homologene: 124480
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Siah2
Name: siah E3 ubiquitin protein ligase 2
Synonyms: Sinh2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20439
Homologene: 21053
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
H1f8
Name: H1.8 linker histone
Synonyms: H1oo, H1foo, H1-8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171506
Homologene: 51377
Letm2
Name: leucine zipper-EF-hand containing transmembrane protein 2
Synonyms: D030041N04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270035
Homologene: 56358
Pxdn
Name: peroxidasin
Synonyms: 2310075M15Rik, VPO1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 69675
Homologene: 33907
Sumf2
Name: sulfatase modifying factor 2
Synonyms: 2610040F05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67902
Homologene: 41037
Sh2b1
Name: SH2B adaptor protein 1
Synonyms: Irip, SH2-Bb, SH2-B, Sh2bpsm1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20399
Homologene: 32122
Tmprss9
Name: transmembrane protease, serine 9
Synonyms: Serase-1B
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432478
VEGA: 10
Homologene: 115302
Vgf
Name: VGF nerve growth factor inducible
Synonyms: LOC381677
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381677
Homologene: 2536
B3glct
Name: beta-3-glucosyltransferase
Synonyms: LOC381694, B3galtl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381694
Homologene: 14978
Herc6
Name: hect domain and RLD 6
Synonyms: 4930427L17Rik, 1700121D12Rik, CEB1, 2510038N07Rik, Herc5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67138
Homologene: 70768
Arhgap26
Name: Rho GTPase activating protein 26
Synonyms: 1810044B20Rik, 2610010G17Rik, 4933432P15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71302
Homologene: 36349
Arhgef19
Name: Rho guanine nucleotide exchange factor 19
Synonyms: 6430573B13Rik, WGEF
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 213649
Homologene: 17710
Or2y1f
Name: olfactory receptor family 2 subfamily Y member 1F
Synonyms: GA_x6K02T2QP88-6141322-6140387, MOR256-25, Olfr1392
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258462
Homologene: 81347
Ceacam5
Name: CEA cell adhesion molecule 5
Synonyms: 1600029H12Rik, Psg30
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73250
Homologene: 115938
Abca7
Name: ATP-binding cassette, sub-family A member 7
Synonyms: Abc51
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27403
HGNC: HGNC:37
Homologene: 22783
Usp21
Name: ubiquitin specific peptidase 21
Synonyms: Usp16, ESTM28, Usp23, W53272
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 30941
Homologene: 56572
Map3k9
Name: mitogen-activated protein kinase kinase kinase 9
Synonyms: Mlk1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 338372
VEGA: 12
HGNC: HGNC:6861
Homologene: 76377
Or8b41
Name: olfactory receptor family 8 subfamily B member 41
Synonyms: GA_x6K02T2PVTD-31822365-31823309, MOR162-3, MOR162-15_p, Olfr890
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258474
Homologene: 138311
Tox2
Name: TOX high mobility group box family member 2
Synonyms: RxHMG1, LOC269389
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269389
Homologene: 13155
Rasl11a
Name: RAS-like, family 11, member A
Synonyms: 1110065D03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68895
Homologene: 45783
Pramel51
Name: PRAME like 51
Synonyms: Gm10436
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100039315
VEGA: 12
Homologene: 103830
Traj46
Name: T cell receptor alpha joining 46
Synonyms: Gm16928
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100124342
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 38,059,243 bp
  • A to G, chromosome 1 at 66,641,629 bp
  • A to G, chromosome 1 at 68,071,630 bp
  • A to T, chromosome 1 at 171,284,717 bp
  • A to G, chromosome 2 at 32,039,360 bp
  • T to A, chromosome 2 at 65,460,673 bp
  • A to G, chromosome 2 at 113,365,040 bp
  • A to G, chromosome 2 at 126,158,531 bp
  • G to T, chromosome 2 at 163,204,630 bp
  • A to T, chromosome 2 at 177,948,519 bp
  • T to C, chromosome 3 at 58,676,082 bp
  • C to T, chromosome 4 at 9,537,722 bp
  • T to A, chromosome 4 at 44,312,191 bp
  • ACTTCTTCTTCTTCTTCTTCTTC to ACTTCTTCTTCTTCTTCTTC, chromosome 4 at 56,781,176 bp
  • G to T, chromosome 4 at 115,063,428 bp
  • A to G, chromosome 4 at 141,250,615 bp
  • C to T, chromosome 5 at 91,090,134 bp
  • T to G, chromosome 5 at 129,860,162 bp
  • A to G, chromosome 5 at 135,381,178 bp
  • A to T, chromosome 5 at 137,032,411 bp
  • T to C, chromosome 5 at 146,845,235 bp
  • G to T, chromosome 5 at 149,579,107 bp
  • T to A, chromosome 5 at 149,726,789 bp
  • A to T, chromosome 6 at 57,598,563 bp
  • ATTT to ATTTT, chromosome 6 at 84,844,095 bp
  • A to T, chromosome 6 at 115,948,784 bp
  • C to T, chromosome 7 at 17,745,699 bp
  • T to C, chromosome 7 at 30,589,956 bp
  • T to A, chromosome 7 at 48,802,999 bp
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp
  • C to CAGCCACGGGGCCTAGCTA, chromosome 7 at 126,467,600 bp
  • T to A, chromosome 7 at 137,199,187 bp
  • C to T, chromosome 8 at 3,600,679 bp
  • T to C, chromosome 8 at 25,581,713 bp
  • G to A, chromosome 8 at 85,261,305 bp
  • T to A, chromosome 9 at 38,143,685 bp
  • A to G, chromosome 10 at 80,006,526 bp
  • A to G, chromosome 10 at 80,894,417 bp
  • A to G, chromosome 10 at 89,812,092 bp
  • C to T, chromosome 11 at 49,293,558 bp
  • A to G, chromosome 11 at 66,156,938 bp
  • T to A, chromosome 11 at 88,834,731 bp
  • C to T, chromosome 11 at 116,349,420 bp
  • T to C, chromosome 12 at 30,011,890 bp
  • T to C, chromosome 12 at 81,734,118 bp
  • T to A, chromosome 12 at 88,177,216 bp
  • A to T, chromosome 13 at 23,762,100 bp
  • A to T, chromosome 14 at 36,890,374 bp
  • A to G, chromosome 14 at 54,172,338 bp
  • A to T, chromosome 14 at 79,359,475 bp
  • C to T, chromosome 16 at 18,245,306 bp
  • T to G, chromosome 17 at 67,737,496 bp
  • T to C, chromosome 18 at 39,111,848 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8456 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067833-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.