Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8510Btlr/Mmmh
Stock Number:
067845-MU
Citation ID:
RRID:MMRRC_067845-MU
Other Names:
R8510 (G1)
Major Collection:

Strain Information

Gldc
Name: glycine decarboxylase
Synonyms: D19Wsu57e, D030049L12Rik, b2b2679Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104174
VEGA: 19
HGNC: HGNC:4313
Homologene: 141
Myo1e
Name: myosin IE
Synonyms: 2310020N23Rik, 9130023P14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71602
VEGA: 9
HGNC: HGNC:7599
Homologene: 55864
Cwf19l2
Name: CWF19 like cell cycle control factor 2
Synonyms: 3230401L03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244672
Homologene: 12366
Usp47
Name: ubiquitin specific peptidase 47
Synonyms: 4930502N04Rik, A630020C16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74996
Homologene: 9929
Mid1
Name: midline 1
Synonyms: Fxy, 61B3-R, DXHXS1141, Trim18
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 17318
HGNC: HGNC:7095
Homologene: 7837
Kif18a
Name: kinesin family member 18A
Synonyms: N-8 kinesin, B130001M12Rik, gcd2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228421
Homologene: 41820
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: MAP1C, dynein heavy chain, retrograde transport, Dnec1, Loa, 9930018I23Rik, Dnchc1, Swl
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Cenpf
Name: centromere protein F
Synonyms: 6530404A22Rik, Lek1, mitosin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108000
HGNC: HGNC:1857
Homologene: 22969
Pias1
Name: protein inhibitor of activated STAT 1
Synonyms: GBP, 2900068C24Rik, Ddxbp1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56469
VEGA: 9
HGNC: HGNC:2752
Homologene: 22953
Strada
Name: STE20-related kinase adaptor alpha
Synonyms: 6030402H20Rik, 2610019A05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72149
Homologene: 12448
Lhx4
Name: LIM homeobox protein 4
Synonyms: Gsh-4, Gsh4, A330062J17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16872
Homologene: 56497
Pole
Name: polymerase (DNA directed), epsilon
Synonyms: pol-epsilon
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18973
HGNC: HGNC:9177
Homologene: 4539
Igf2r
Name: insulin-like growth factor 2 receptor
Synonyms: Mpr300, CI-MPR, IGF-II/CI-MPR, M6P/IGF2R, CD222, mannose-6-phosphate receptor, cation independent
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16004
HGNC: HGNC:5467
Homologene: 676
Exosc10
Name: exosome component 10
Synonyms: PM/Scl-100, PM-Scl, RRP6, p4, p3, p2, Pmscl2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50912
HGNC: HGNC:9138
Homologene: 31105
Emc3
Name: ER membrane protein complex subunit 3
Synonyms: 0610039A15Rik, Tmem111
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66087
Homologene: 100707
Pcdh12
Name: protocadherin 12
Synonyms: VE-cadherin-2, vascular endothelial cadherin-2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 53601
HGNC: HGNC:8657
Homologene: 9574
Pcolce2
Name: procollagen C-endopeptidase enhancer 2
Synonyms: Pcpe2, 2400001O18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76477
HGNC: HGNC:8739
Homologene: 8357
Avil
Name: advillin
Synonyms: DOC6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11567
Homologene: 38200
Dach1
Name: dachshund family transcription factor 1
Synonyms: Dac, E130112M23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13134
HGNC: HGNC:2663
Homologene: 7288
Ncoa1
Name: nuclear receptor coactivator 1
Synonyms: SRC-a/NCoA-1, SRC-1, SRC1, steroid receptor coactivator-1, KAT13A, bHLHe74
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17977
VEGA: 12
HGNC: HGNC:7668
Homologene: 7859
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Casp1
Name: caspase 1
Synonyms: ICE, Caspase-1, interleukin 1 beta-converting enzyme, Il1bc
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12362
VEGA: 9
HGNC: HGNC:1499
Homologene: 133272
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Fhip2a
Name: FHF complex subunit HOOK interacting protein 2A
Synonyms: Fam160b1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226252
VEGA: 19
Homologene: 28133
Col5a3
Name: collagen, type V, alpha 3
Synonyms: Pro-alpha3(V)
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 53867
Homologene: 9253
Tubgcp6
Name: tubulin, gamma complex component 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328580
Homologene: 32477
Vmn2r116
Name: vomeronasal 2, receptor 116
Synonyms: EG619697, V2Rp5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 619697
Homologene: 86604
Rin2
Name: Ras and Rab interactor 2
Synonyms: RASSF4, 4632403N06Rik, 2010003K16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74030
Homologene: 32430
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Klc4
Name: kinesin light chain 4
Synonyms: 1200014P03Rik, Knsl8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74764
VEGA: 17
Homologene: 12584
Or2ag19
Name: olfactory receptor family 2 subfamily AG member 19
Synonyms: GA_x6K02T2PBJ9-9222217-9223176, MOR283-7, Olfr703
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258589
Unc79
Name: unc-79 homolog
Synonyms: 9030205A07Rik, Mlca3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217843
Homologene: 41397
Or52e18
Name: olfactory receptor family 52 subfamily E member 18
Synonyms: GA_x6K02T2PBJ9-7589577-7588639, MOR32-8, Olfr670
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384703
Homologene: 105163
Rbbp8
Name: retinoblastoma binding protein 8, endonuclease
Synonyms: 9930104E21Rik, CtIP
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225182
VEGA: 18
HGNC: HGNC:9891
Homologene: 28546
Crybg2
Name: crystallin beta-gamma domain containing 2
Synonyms: Aim1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230806
Homologene: 19232
Celsr3
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: Fmi1, flamingo, Adgrc3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 107934
HGNC: HGNC:3230
Homologene: 1077
Ttc28
Name: tetratricopeptide repeat domain 28
Synonyms: 2310015L07Rik, TPRBK
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 209683
Homologene: 41023
Usp4
Name: ubiquitin specific peptidase 4 (proto-oncogene)
Synonyms: Unp, F730026I20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22258
Homologene: 20716
Gss
Name: glutathione synthetase
Synonyms: GS-A/GS-B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14854
HGNC: HGNC:4624
Homologene: 148
Pga5
Name: pepsinogen 5, group I
Synonyms: 1110035E17Rik, pepsinogen A5, Pepf
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58803
VEGA: 19
Homologene: 105932
Or10j3
Name: olfactory receptor family 10 subfamily J member 3B
Synonyms: GA_x6K02SYWG4P-534-1100, GA_x6K02T2R7CC-643715-642847, MOR267-3, MOR267-3, Olfr1405-ps1, Olfr218
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258880
Homologene: 105155
Fbxl12
Name: F-box and leucine-rich repeat protein 12
Synonyms: 3110048D16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 30843
Homologene: 32198
Plscr4
Name: phospholipid scramblase 4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235527
Homologene: 23217
Cfap221
Name: cilia and flagella associated protein 221
Synonyms: Pcdp1, Gm101
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226356
Homologene: 88578
Spatc1
Name: spermatogenesis and centriole associated 1
Synonyms: 1700084J23Rik, speriolin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74281
VEGA: 15
Homologene: 129861
Spata31e3
Name: spermatogenesis associated 31 subfamily E member 3
Synonyms: LOC380882, Gm906
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 380882
VEGA: 13
Homologene: 134512
Gpam
Name: glycerol-3-phosphate acyltransferase, mitochondrial
Synonyms: GPAT1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14732
Homologene: 7343
Adgrf2
Name: adhesion G protein-coupled receptor F2
Synonyms: PGR20, Gpr111
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 435529
Homologene: 45213
Phyh
Name: phytanoyl-CoA hydroxylase
Synonyms: Lnap1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16922
HGNC: HGNC:8940
Homologene: 4530
Upp2
Name: uridine phosphorylase 2
Synonyms: UDRPASE2, UPASE2, UP2, 1700124F02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76654
Homologene: 12654
Plat
Name: plasminogen activator, tissue
Synonyms: t-PA, tPA, D8Ertd2e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18791
HGNC: HGNC:9051
Homologene: 717
Kcnf1
Name: potassium voltage-gated channel, subfamily F, member 1
Synonyms: LOC382571
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 382571
HGNC: HGNC:6246
Homologene: 124236
Wdr74
Name: WD repeat domain 74
Synonyms: 5730436H21Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107071
Homologene: 41226
Top1mt
Name: DNA topoisomerase 1, mitochondrial
Synonyms: 2900052H09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72960
Homologene: 43082
Or52b4
Name: olfactory receptor family 52 subfamily B member 4
Synonyms: GA_x6K02T2PBJ9-5256044-5256988, MOR31-4, Olfr547
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259083
Homologene: 17493
Npas2
Name: neuronal PAS domain protein 2
Synonyms: MOP4, bHLHe9
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18143
HGNC: HGNC:7895
Homologene: 1887
Cmtr2
Name: cap methyltransferase 2
Synonyms: C730036L12Rik, Ftsjd1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234728
Homologene: 10144
Or6c213
Name: olfactory receptor family 6 subfamily C member 213
Synonyms: GA_x6K02T2PULF-11417610-11416669, MOR110-5, MOR110-12, Olfr806
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258546
Homologene: 73936
Gm11077
Name: predicted gene 11077
Type: Gene
Species: Mouse
Chromosome: 6
Nps
Name: neuropeptide S
Synonyms: ENSMUSG00000073804
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043254
Homologene: 106066
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 39,287,472 bp
  • T to A, chromosome 1 at 119,989,447 bp
  • G to T, chromosome 1 at 155,702,301 bp
  • T to C, chromosome 1 at 173,203,844 bp
  • A to T, chromosome 1 at 189,650,706 bp
  • A to G, chromosome 2 at 4,927,433 bp
  • T to C, chromosome 2 at 58,780,106 bp
  • T to A, chromosome 2 at 109,296,764 bp
  • T to A, chromosome 2 at 145,885,691 bp
  • G to A, chromosome 2 at 155,567,824 bp
  • C to A, chromosome 4 at 134,073,359 bp
  • T to C, chromosome 4 at 148,564,189 bp
  • T to C, chromosome 5 at 110,334,446 bp
  • G to A, chromosome 5 at 111,233,341 bp
  • A to T, chromosome 5 at 137,388,938 bp
  • G to T, chromosome 6 at 113,531,389 bp
  • A to G, chromosome 6 at 140,729,306 bp
  • A to G, chromosome 7 at 102,534,963 bp
  • G to T, chromosome 7 at 104,960,114 bp
  • A to G, chromosome 7 at 106,844,923 bp
  • A to G, chromosome 7 at 112,059,001 bp
  • C to T, chromosome 7 at 135,272,350 bp
  • GCAGCCCCCACAGGAACTACAACCACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGA to GCAGCCCCCACAGGA, chromosome 7 at 142,165,288 bp
  • G to T, chromosome 8 at 22,772,232 bp
  • T to C, chromosome 8 at 110,222,435 bp
  • T to A, chromosome 8 at 110,506,570 bp
  • A to G, chromosome 9 at 3,454,732 bp
  • G to A, chromosome 9 at 5,303,026 bp
  • C to A, chromosome 9 at 20,638,864 bp
  • A to T, chromosome 9 at 20,793,732 bp
  • C to T, chromosome 9 at 62,923,637 bp
  • C to T, chromosome 9 at 70,335,265 bp
  • C to T, chromosome 9 at 92,490,790 bp
  • T to C, chromosome 9 at 95,681,647 bp
  • T to A, chromosome 9 at 108,388,382 bp
  • T to C, chromosome 9 at 108,838,120 bp
  • A to G, chromosome 10 at 127,009,781 bp
  • A to G, chromosome 10 at 129,738,185 bp
  • T to C, chromosome 11 at 106,171,158 bp
  • T to C, chromosome 12 at 4,259,303 bp
  • T to A, chromosome 12 at 17,175,938 bp
  • T to A, chromosome 12 at 103,104,639 bp
  • T to A, chromosome 12 at 110,616,743 bp
  • T to C, chromosome 13 at 50,250,192 bp
  • T to C, chromosome 14 at 97,903,159 bp
  • A to G, chromosome 15 at 75,669,302 bp
  • A to G, chromosome 15 at 76,292,312 bp
  • C to A, chromosome 15 at 89,102,949 bp
  • CAC to CACTAC, chromosome 16 at 32,754,076 bp
  • A to G, chromosome 17 at 12,704,313 bp
  • A to T, chromosome 17 at 23,385,931 bp
  • A to T, chromosome 17 at 42,719,540 bp
  • G to A, chromosome 17 at 46,644,304 bp
  • A to T, chromosome 18 at 11,696,802 bp
  • T to C, chromosome 18 at 38,282,056 bp
  • T to A, chromosome 19 at 8,737,910 bp
  • C to T, chromosome 19 at 10,677,944 bp
  • T to A, chromosome 19 at 30,116,505 bp
  • A to G, chromosome 19 at 55,080,382 bp
  • A to T, chromosome 19 at 57,382,320 bp
  • A to G, chromosome X at 169,985,023 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8510 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067845-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.