Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8510Btlr/Mmmh
Stock Number:
067845-MU
Citation ID:
RRID:MMRRC_067845-MU
Other Names:
R8510 (G1)
Major Collection:

Strain Information

Gldc
Name: glycine decarboxylase
Synonyms: D19Wsu57e, D030049L12Rik, b2b2679Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104174
VEGA: 19
HGNC: HGNC:4313
Homologene: 141
Myo1e
Name: myosin IE
Synonyms: 2310020N23Rik, 9130023P14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71602
VEGA: 9
HGNC: HGNC:7599
Homologene: 55864
Cwf19l2
Name: CWF19 like cell cycle control factor 2
Synonyms: 3230401L03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244672
Homologene: 12366
Usp47
Name: ubiquitin specific peptidase 47
Synonyms: 4930502N04Rik, A630020C16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74996
Homologene: 9929
Mid1
Name: midline 1
Synonyms: Fxy, 61B3-R, DXHXS1141, Trim18
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 17318
HGNC: HGNC:7095
Homologene: 7837
Kif18a
Name: kinesin family member 18A
Synonyms: N-8 kinesin, B130001M12Rik, gcd2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228421
Homologene: 41820
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: MAP1C, dynein heavy chain, retrograde transport, Dnec1, Loa, 9930018I23Rik, Dnchc1, Swl
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 39,287,472 bp
  • T to A, chromosome 1 at 119,989,447 bp
  • G to T, chromosome 1 at 155,702,301 bp
  • T to C, chromosome 1 at 173,203,844 bp
  • A to T, chromosome 1 at 189,650,706 bp
  • A to G, chromosome 2 at 4,927,433 bp
  • T to C, chromosome 2 at 58,780,106 bp
  • T to A, chromosome 2 at 109,296,764 bp
  • T to A, chromosome 2 at 145,885,691 bp
  • G to A, chromosome 2 at 155,567,824 bp
  • C to A, chromosome 4 at 134,073,359 bp
  • T to C, chromosome 4 at 148,564,189 bp
  • T to C, chromosome 5 at 110,334,446 bp
  • G to A, chromosome 5 at 111,233,341 bp
  • A to T, chromosome 5 at 137,388,938 bp
  • G to T, chromosome 6 at 113,531,389 bp
  • A to G, chromosome 6 at 140,729,306 bp
  • A to G, chromosome 7 at 102,534,963 bp
  • G to T, chromosome 7 at 104,960,114 bp
  • A to G, chromosome 7 at 106,844,923 bp
  • A to G, chromosome 7 at 112,059,001 bp
  • C to T, chromosome 7 at 135,272,350 bp
  • GCAGCCCCCACAGGAACTACAACCACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGA to GCAGCCCCCACAGGA, chromosome 7 at 142,165,288 bp
  • G to T, chromosome 8 at 22,772,232 bp
  • T to C, chromosome 8 at 110,222,435 bp
  • T to A, chromosome 8 at 110,506,570 bp
  • A to G, chromosome 9 at 3,454,732 bp
  • G to A, chromosome 9 at 5,303,026 bp
  • C to A, chromosome 9 at 20,638,864 bp
  • A to T, chromosome 9 at 20,793,732 bp
  • C to T, chromosome 9 at 62,923,637 bp
  • C to T, chromosome 9 at 70,335,265 bp
  • C to T, chromosome 9 at 92,490,790 bp
  • T to C, chromosome 9 at 95,681,647 bp
  • T to A, chromosome 9 at 108,388,382 bp
  • T to C, chromosome 9 at 108,838,120 bp
  • A to G, chromosome 10 at 127,009,781 bp
  • A to G, chromosome 10 at 129,738,185 bp
  • T to C, chromosome 11 at 106,171,158 bp
  • T to C, chromosome 12 at 4,259,303 bp
  • T to A, chromosome 12 at 17,175,938 bp
  • T to A, chromosome 12 at 103,104,639 bp
  • T to A, chromosome 12 at 110,616,743 bp
  • T to C, chromosome 13 at 50,250,192 bp
  • T to C, chromosome 14 at 97,903,159 bp
  • A to G, chromosome 15 at 75,669,302 bp
  • A to G, chromosome 15 at 76,292,312 bp
  • C to A, chromosome 15 at 89,102,949 bp
  • CAC to CACTAC, chromosome 16 at 32,754,076 bp
  • A to G, chromosome 17 at 12,704,313 bp
  • A to T, chromosome 17 at 23,385,931 bp
  • A to T, chromosome 17 at 42,719,540 bp
  • G to A, chromosome 17 at 46,644,304 bp
  • A to T, chromosome 18 at 11,696,802 bp
  • T to C, chromosome 18 at 38,282,056 bp
  • T to A, chromosome 19 at 8,737,910 bp
  • C to T, chromosome 19 at 10,677,944 bp
  • T to A, chromosome 19 at 30,116,505 bp
  • A to G, chromosome 19 at 55,080,382 bp
  • A to T, chromosome 19 at 57,382,320 bp
  • A to G, chromosome X at 169,985,023 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8510 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067845-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.