Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8512Btlr/Mmmh
Stock Number:
067846-MU
Citation ID:
RRID:MMRRC_067846-MU
Other Names:
R8512 (G1)
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Dtnbp1
Name: dystrobrevin binding protein 1
Synonyms: dysbindin, 5430437B18Rik, sdy, Bloc1s8
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 94245
VEGA: 13
Homologene: 12037
Chtf8
Name: CTF8, chromosome transmission fidelity factor 8
Synonyms: 5830457O10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 214987
Homologene: 84588
Ggnbp2
Name: gametogenetin binding protein 2
Synonyms: DIF-3, Zfp403, D330017P12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217039
Homologene: 11750
Esrrg
Name: estrogen-related receptor gamma
Synonyms: estrogen-related receptor 3, ERR3, Errg, NR3B3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26381
HGNC: HGNC:3474
Homologene: 55581
Etaa1
Name: Ewing tumor-associated antigen 1
Synonyms: 5730466H23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68145
Homologene: 10369
Ttc17
Name: tetratricopeptide repeat domain 17
Synonyms: D2Bwg1005e, 9130020K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74569
Homologene: 10100
Fcho2
Name: FCH domain only 2
Synonyms: 5832424M12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218503
VEGA: 13
Homologene: 9030
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Tle1
Name: transducin-like enhancer of split 1
Synonyms: Grg1, Estm14, C230057C06Rik, Tle4l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21885
Homologene: 21058
Mynn
Name: myoneurin
Synonyms: SBBIZ1, 2810011C24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80732
Homologene: 10253
Irak4
Name: interleukin-1 receptor-associated kinase 4
Synonyms: NY-REN-64, IRAK-4, 9330209D03Rik, 8430405M07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 266632
Homologene: 41109
Traf3
Name: TNF receptor-associated factor 3
Synonyms: LAP1, CAP-1, CD40bp, CRAF1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22031
Homologene: 7981
Slc6a11
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 11
Synonyms: GAT4, D930045G19Rik, E130202I16Rik, Gabt4, Gat3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243616
Homologene: 129935
Ckmt1
Name: creatine kinase, mitochondrial 1, ubiquitous
Synonyms: Mt-CK, mi-CK, UbCKmit
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12716
Homologene: 69058
Sptb
Name: spectrin beta, erythrocytic
Synonyms: Spnb-1, spectrin R, LOC383567, D330027P03Rik, brain erythroid spectrin (235E), Spnb1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20741
Homologene: 295
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Kirrel1
Name: kirre like nephrin family adhesion molecule 1
Synonyms: Neph1, Kirrel1, 6720469N11Rik, Kirrel
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170643
Homologene: 10089
Pnisr
Name: PNN interacting serine/arginine-rich
Synonyms: 5730406M06Rik, Sfrs18
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66625
Homologene: 32802
Dnajb2
Name: DnaJ heat shock protein family (Hsp40) member B2
Synonyms: mDj8, 2700059H22Rik, Dnajb10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56812
HGNC: HGNC:5228
Homologene: 4902
Msantd2
Name: Myb/SANT-like DNA-binding domain containing 2
Synonyms: 2810450G17Rik, 9530092B10Rik, BC024479
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235184
Homologene: 36421
Susd2
Name: sushi domain containing 2
Synonyms: 1200011D11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71733
VEGA: 10
Homologene: 10481
Map4k1
Name: mitogen-activated protein kinase kinase kinase kinase 1
Synonyms: Hpk1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26411
HGNC: HGNC:6863
Homologene: 5199
Ttn
Name: titin
Synonyms: connectin, L56, 1100001C23Rik, mdm, 2310036G12Rik, D830007G01Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Sec24c
Name: SEC24 homolog C, COPII coat complex component
Synonyms: 2610204K03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218811
VEGA: 14
Homologene: 3615
Celsr2
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: flamingo, mfmi1, EGFL2, Adgrc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53883
HGNC: HGNC:3231
Homologene: 1078
Psmb9
Name: proteasome (prosome, macropain) subunit, beta type 9 (large multifunctional peptidase 2)
Synonyms: Lmp-2, Lmp2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16912
HGNC: HGNC:9546
Homologene: 2094
Myh2
Name: myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms: MyHC-IIa, MHC2A, Myhs-f1, Myhs-f, Myhsf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17882
HGNC: HGNC:7572
Homologene: 23019
Naglu
Name: alpha-N-acetylglucosaminidase (Sanfilippo disease IIIB)
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27419
HGNC: HGNC:7632
Homologene: 222
Ptprt
Name: protein tyrosine phosphatase receptor type T
Synonyms: RPTPrho
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19281
HGNC: HGNC:9682
Homologene: 56924
Rev3l
Name: REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms: Sez4, Rev
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19714
HGNC: HGNC:9968
Homologene: 48147
Adgre4
Name: adhesion G protein-coupled receptor E4
Synonyms: EGF-TM7, D17Ertd479e, FIRE, Gpr127, Emr4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 52614
VEGA: 17
Homologene: 64640
Or10al3
Name: olfactory receptor family 10 subfamily AL member 3
Synonyms: GA_x6K02T2PSCP-2159633-2160598, MOR263-7, Olfr119
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258095
Homologene: 17195
Rtl1
Name: retrotransposon Gaglike 1
Synonyms: Mart1, Mor1, Mar
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 353326
VEGA: 12
Homologene: 120261
Slc2a7
Name: solute carrier family 2 (facilitated glucose transporter), member 7
Synonyms: OTTMUSG00000010396
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 435818
Homologene: 72470
Evi5l
Name: ecotropic viral integration site 5 like
Synonyms: 3110007G05Rik, 1700084G18Rik, 2310039H16Rik, B130050I23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 213027
Homologene: 134635
Synpo
Name: synaptopodin
Synonyms: 9330140I15Rik, 9030217H17Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 104027
Homologene: 5274
Tdrd9
Name: tudor domain containing 9
Synonyms: 4930441E05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74691
Homologene: 14311
Rftn2
Name: raftlin family member 2
Synonyms: 2700010E02Rik, 3222401M22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74013
Homologene: 16954
Yipf7
Name: Yip1 domain family, member 7
Synonyms: Yip1b, 2310016N21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75581
Homologene: 69367
Ces3a
Name: carboxylesterase 3A
Synonyms: Es-male carboxylesterase, Es31
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382053
HGNC: HGNC:1865
Homologene: 84407
Or6c75
Name: olfactory receptor family 6 subfamily C member 75
Synonyms: GA_x6K02T2PULF-11179777-11180721, MOR112-1, Olfr790
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258935
Homologene: 74101
Gsdmc4
Name: gasdermin C4
Synonyms: 9030605I04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74548
HGNC: HGNC:7151
Homologene: 69487
P2rx3
Name: purinergic receptor P2X, ligand-gated ion channel, 3
Synonyms: P2X3, 4930513E20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228139
HGNC: HGNC:8534
Homologene: 1922
Xbp1
Name: X-box binding protein 1
Synonyms: XBP-1, TREB-5, TREB5, D11Ertd39e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22433
Homologene: 3722
Lrrc30
Name: leucine rich repeat containing 30
Synonyms: LOC240131
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240131
VEGA: 17
Homologene: 33184
Msantd5
Name: Myb/SANT DNA binding domain containing 5
Synonyms: Gm12569
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 622699
Homologene: 141209
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 55,214,165 bp
  • C to T, chromosome 1 at 75,241,431 bp
  • T to G, chromosome 1 at 188,043,580 bp
  • G to C, chromosome 2 at 76,868,348 bp
  • T to C, chromosome 2 at 76,916,767 bp
  • C to T, chromosome 2 at 85,024,411 bp
  • G to A, chromosome 2 at 94,371,763 bp
  • A to T, chromosome 2 at 121,361,208 bp
  • A to G, chromosome 2 at 161,558,863 bp
  • C to T, chromosome 3 at 30,616,649 bp
  • A to G, chromosome 3 at 87,088,227 bp
  • A to G, chromosome 3 at 108,413,838 bp
  • C to T, chromosome 4 at 21,870,372 bp
  • T to G, chromosome 4 at 72,122,433 bp
  • T to C, chromosome 4 at 150,163,295 bp
  • C to T, chromosome 5 at 69,517,044 bp
  • T to C, chromosome 6 at 114,238,441 bp
  • C to T, chromosome 7 at 28,996,158 bp
  • T to C, chromosome 7 at 75,611,086 bp
  • G to T, chromosome 7 at 140,048,971 bp
  • A to G, chromosome 8 at 4,193,121 bp
  • A to T, chromosome 8 at 105,058,029 bp
  • G to A, chromosome 8 at 106,885,434 bp
  • T to C, chromosome 9 at 18,638,192 bp
  • T to C, chromosome 9 at 37,522,935 bp
  • A to G, chromosome 10 at 39,821,538 bp
  • G to A, chromosome 10 at 75,639,651 bp
  • T to A, chromosome 10 at 129,501,627 bp
  • T to C, chromosome 11 at 5,524,266 bp
  • G to A, chromosome 11 at 17,947,442 bp
  • T to A, chromosome 11 at 51,234,660 bp
  • AGCTGCTGCTGCTGCTGCTGCTGCTG to AGCTGCTGCTGCTGCTGCTGCTG, chromosome 11 at 62,433,611 bp
  • T to C, chromosome 11 at 67,190,361 bp
  • C to T, chromosome 11 at 84,837,989 bp
  • T to C, chromosome 11 at 101,070,342 bp
  • T to A, chromosome 12 at 8,961,183 bp
  • T to C, chromosome 12 at 76,602,052 bp
  • T to A, chromosome 12 at 109,594,617 bp
  • A to T, chromosome 12 at 111,261,992 bp
  • G to A, chromosome 12 at 112,046,193 bp
  • G to T, chromosome 13 at 44,922,391 bp
  • T to C, chromosome 13 at 98,755,222 bp
  • T to C, chromosome 14 at 20,690,852 bp
  • C to T, chromosome 15 at 63,835,015 bp
  • A to G, chromosome 15 at 63,891,959 bp
  • A to C, chromosome 15 at 94,566,778 bp
  • C to T, chromosome 17 at 34,183,628 bp
  • T to A, chromosome 17 at 37,701,180 bp
  • T to C, chromosome 17 at 55,818,760 bp
  • T to A, chromosome 17 at 67,631,952 bp
  • C to T, chromosome 18 at 60,602,411 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8512 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067846-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.