Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8355Btlr/Mmmh
Stock Number:
067869-MU
Citation ID:
RRID:MMRRC_067869-MU
Other Names:
R8355 (G1)
Major Collection:

Strain Information

Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Tet1
Name: tet methylcytosine dioxygenase 1
Synonyms: 2510010B09Rik, D10Ertd17e, Cxxc6, BB001228
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52463
Homologene: 12735
Itch
Name: itchy, E3 ubiquitin protein ligase
Synonyms: 6720481N21Rik, C230047C07Rik, 8030492O04Rik, AIP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16396
Homologene: 88442
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Zbtb43
Name: zinc finger and BTB domain containing 43
Synonyms: 1700010E06Rik, Zfp297b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71834
Homologene: 8514
Ggnbp2
Name: gametogenetin binding protein 2
Synonyms: DIF-3, Zfp403, D330017P12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217039
Homologene: 11750
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 129,595,879 bp
  • T to C, chromosome 1 at 135,267,267 bp
  • T to C, chromosome 1 at 178,017,710 bp
  • T to C, chromosome 1 at 193,351,047 bp
  • C to T, chromosome 2 at 33,455,108 bp
  • C to T, chromosome 2 at 69,516,484 bp
  • T to A, chromosome 2 at 85,648,141 bp
  • T to A, chromosome 2 at 150,267,956 bp
  • T to A, chromosome 2 at 155,210,582 bp
  • T to A, chromosome 3 at 113,530,396 bp
  • A to G, chromosome 4 at 42,933,735 bp
  • A to G, chromosome 4 at 43,422,846 bp
  • C to A, chromosome 4 at 131,808,500 bp
  • T to C, chromosome 4 at 133,720,863 bp
  • C to A, chromosome 4 at 156,203,380 bp
  • G to T, chromosome 5 at 21,251,019 bp
  • T to A, chromosome 5 at 25,354,501 bp
  • T to C, chromosome 5 at 94,383,913 bp
  • A to G, chromosome 5 at 110,111,982 bp
  • ACCCAGCACCTGGAGATCGTCC to ACC, chromosome 5 at 139,161,859 bp
  • G to A, chromosome 6 at 40,254,935 bp
  • C to T, chromosome 6 at 90,203,465 bp
  • A to T, chromosome 6 at 142,692,752 bp
  • T to A, chromosome 6 at 145,865,302 bp
  • G to A, chromosome 7 at 7,278,222 bp
  • A to G, chromosome 7 at 16,883,200 bp
  • G to T, chromosome 7 at 79,435,281 bp
  • A to T, chromosome 7 at 81,473,103 bp
  • A to C, chromosome 7 at 81,968,876 bp
  • A to T, chromosome 7 at 104,769,545 bp
  • A to T, chromosome 7 at 106,158,105 bp
  • T to G, chromosome 7 at 119,952,208 bp
  • T to A, chromosome 7 at 139,875,651 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp
  • C to A, chromosome 7 at 142,273,957 bp
  • T to A, chromosome 8 at 4,234,018 bp
  • C to A, chromosome 8 at 22,771,742 bp
  • T to C, chromosome 8 at 37,723,085 bp
  • T to C, chromosome 8 at 71,480,566 bp
  • T to C, chromosome 8 at 124,870,840 bp
  • A to G, chromosome 9 at 20,300,419 bp
  • A to G, chromosome 9 at 38,108,962 bp
  • T to C, chromosome 9 at 59,909,847 bp
  • T to C, chromosome 9 at 96,150,786 bp
  • A to G, chromosome 9 at 103,499,870 bp
  • A to G, chromosome 9 at 104,326,975 bp
  • A to G, chromosome 9 at 123,173,823 bp
  • G to A, chromosome 9 at 123,454,715 bp
  • G to A, chromosome 10 at 41,399,704 bp
  • T to A, chromosome 10 at 62,816,450 bp
  • C to A, chromosome 10 at 76,493,501 bp
  • T to C, chromosome 10 at 81,487,869 bp
  • C to T, chromosome 10 at 107,382,636 bp
  • G to T, chromosome 11 at 49,340,765 bp
  • A to T, chromosome 11 at 76,250,338 bp
  • C to T, chromosome 11 at 77,692,433 bp
  • C to T, chromosome 11 at 84,837,989 bp
  • G to A, chromosome 11 at 87,814,288 bp
  • A to T, chromosome 11 at 94,570,624 bp
  • A to T, chromosome 11 at 97,241,974 bp
  • A to T, chromosome 12 at 112,679,535 bp
  • A to T, chromosome 12 at 113,271,547 bp
  • A to T, chromosome 13 at 9,878,610 bp
  • A to T, chromosome 13 at 38,019,249 bp
  • A to T, chromosome 13 at 100,468,995 bp
  • T to C, chromosome 15 at 8,335,044 bp
  • C to A, chromosome 15 at 76,034,224 bp
  • T to C, chromosome 15 at 76,119,807 bp
  • A to G, chromosome 16 at 27,417,351 bp
  • A to G, chromosome 17 at 3,685,923 bp
  • T to G, chromosome 17 at 18,184,799 bp
  • A to G, chromosome 17 at 18,440,090 bp
  • T to A, chromosome 17 at 28,903,275 bp
  • A to C, chromosome 17 at 30,695,178 bp
  • A to G, chromosome 17 at 34,648,223 bp
  • G to T, chromosome 18 at 37,412,081 bp
  • T to C, chromosome 18 at 61,128,150 bp
  • A to T, chromosome 18 at 63,090,998 bp
  • T to A, chromosome 18 at 80,207,324 bp
  • G to A, chromosome 18 at 89,028,892 bp
  • T to C, chromosome 19 at 5,484,192 bp
  • T to C, chromosome 19 at 8,959,262 bp
  • A to G, chromosome 19 at 41,646,034 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8355 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067869-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.