Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8439Btlr/Mmmh
Stock Number:
067883-MU
Citation ID:
RRID:MMRRC_067883-MU
Other Names:
R8439 (G1)
Major Collection:

Strain Information

Myo10
Name: myosin X
Synonyms: myosin-X, D15Ertd600e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17909
HGNC: HGNC:7593
Homologene: 36328
Dspp
Name: dentin sialophosphoprotein
Synonyms: Dmp3, Dpp, Dsp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 666279
HGNC: HGNC:3054
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Gdnf
Name: glial cell line derived neurotrophic factor
Synonyms: glial cell line-derived neurotrophic factor
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14573
VEGA: 15
HGNC: HGNC:4232
Homologene: 433
Pcnt
Name: pericentrin (kendrin)
Synonyms: Pcnt2, m275Asp, m239Asp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Ahctf1
Name: AT hook containing transcription factor 1
Synonyms: 6230412P20Rik, Elys
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226747
Homologene: 9142
Dlx2
Name: distal-less homeobox 2
Synonyms: Tes-1, DII A, Dlx-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13392
HGNC: HGNC:2915
Homologene: 3244
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 15,312,710 bp
  • T to A, chromosome 1 at 31,223,268 bp
  • T to G, chromosome 1 at 151,449,976 bp
  • T to C, chromosome 1 at 179,762,610 bp
  • T to A, chromosome 1 at 188,850,057 bp
  • A to G, chromosome 2 at 10,235,058 bp
  • A to T, chromosome 2 at 71,545,538 bp
  • T to A, chromosome 2 at 77,059,550 bp
  • G to A, chromosome 2 at 82,977,086 bp
  • A to T, chromosome 2 at 87,693,744 bp
  • C to T, chromosome 2 at 89,994,004 bp
  • A to G, chromosome 2 at 117,270,900 bp
  • A to G, chromosome 2 at 121,510,698 bp
  • G to T, chromosome 2 at 122,298,155 bp
  • A to G, chromosome 2 at 130,770,701 bp
  • T to C, chromosome 2 at 135,250,052 bp
  • A to G, chromosome 2 at 143,955,133 bp
  • G to T, chromosome 3 at 104,652,833 bp
  • A to G, chromosome 3 at 155,188,236 bp
  • T to C, chromosome 4 at 46,492,814 bp
  • C to A, chromosome 4 at 99,083,029 bp
  • C to A, chromosome 4 at 115,457,775 bp
  • A to G, chromosome 4 at 147,332,351 bp
  • T to G, chromosome 5 at 92,425,746 bp
  • C to A, chromosome 5 at 104,177,296 bp
  • T to C, chromosome 6 at 4,755,462 bp
  • T to C, chromosome 6 at 41,135,365 bp
  • T to C, chromosome 6 at 132,855,577 bp
  • T to C, chromosome 6 at 142,461,195 bp
  • T to C, chromosome 6 at 147,000,950 bp
  • G to T, chromosome 7 at 3,497,521 bp
  • A to G, chromosome 7 at 42,580,678 bp
  • C to T, chromosome 7 at 139,987,849 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • T to A, chromosome 9 at 20,286,041 bp
  • T to C, chromosome 9 at 75,529,398 bp
  • G to A, chromosome 9 at 108,111,452 bp
  • G to C, chromosome 10 at 29,334,246 bp
  • G to A, chromosome 10 at 76,420,205 bp
  • A to T, chromosome 10 at 80,006,161 bp
  • T to C, chromosome 11 at 22,096,109 bp
  • T to C, chromosome 11 at 62,850,588 bp
  • T to A, chromosome 11 at 70,011,728 bp
  • A to G, chromosome 11 at 98,428,972 bp
  • C to A, chromosome 11 at 120,274,589 bp
  • T to C, chromosome 12 at 65,055,262 bp
  • T to C, chromosome 14 at 43,819,247 bp
  • T to C, chromosome 14 at 50,127,147 bp
  • G to A, chromosome 14 at 54,625,556 bp
  • G to T, chromosome 15 at 7,834,653 bp
  • A to G, chromosome 15 at 25,725,072 bp
  • G to A, chromosome 15 at 79,630,070 bp
  • A to T, chromosome 16 at 30,561,751 bp
  • A to G, chromosome 16 at 36,946,641 bp
  • G to T, chromosome 17 at 20,846,608 bp
  • CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT to CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT, chromosome 17 at 30,760,867 bp
  • A to G, chromosome 17 at 37,093,772 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8439 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067883-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.