Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8439Btlr/Mmmh
Stock Number:
067883-MU
Citation ID:
RRID:MMRRC_067883-MU
Other Names:
R8439 (G1)
Major Collection:

Strain Information

Myo10
Name: myosin X
Synonyms: myosin-X, D15Ertd600e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17909
HGNC: HGNC:7593
Homologene: 36328
Dspp
Name: dentin sialophosphoprotein
Synonyms: Dmp3, Dpp, Dsp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 666279
HGNC: HGNC:3054
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Gdnf
Name: glial cell line derived neurotrophic factor
Synonyms: glial cell line-derived neurotrophic factor
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14573
VEGA: 15
HGNC: HGNC:4232
Homologene: 433
Pcnt
Name: pericentrin (kendrin)
Synonyms: Pcnt2, m275Asp, m239Asp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Ahctf1
Name: AT hook containing transcription factor 1
Synonyms: 6230412P20Rik, Elys
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226747
Homologene: 9142
Dlx2
Name: distal-less homeobox 2
Synonyms: Tes-1, DII A, Dlx-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13392
HGNC: HGNC:2915
Homologene: 3244
Adam8
Name: a disintegrin and metallopeptidase domain 8
Synonyms: CD156, MS2, E430039A18Rik, CD156a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11501
HGNC: HGNC:215
Homologene: 74384
Wdr76
Name: WD repeat domain 76
Synonyms: 5830411K18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241627
Homologene: 38573
Ccdc141
Name: coiled-coil domain containing 141
Synonyms: ENSMUSG00000075261, CAMDI, 2610301F02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545428
Homologene: 52149
Acadvl
Name: acyl-Coenzyme A dehydrogenase, very long chain
Synonyms: VLCAD
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11370
HGNC: HGNC:92
Homologene: 5
Dock7
Name: dedicator of cytokinesis 7
Synonyms: 3110056M06Rik, LOC242555, m
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67299
Homologene: 23566
Prpf39
Name: pre-mRNA processing factor 39
Synonyms: Srcs1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 328110
Homologene: 32377
Itih5
Name: inter-alpha-trypsin inhibitor, heavy chain 5
Synonyms: 5430408M01Rik, 4631408O11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209378
Homologene: 57115
Slc16a1
Name: solute carrier family 16 (monocarboxylic acid transporters), member 1
Synonyms: MCT1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20501
Homologene: 20662
Lsg1
Name: large 60S subunit nuclear export GTPase 1
Synonyms: D16Bwg1547e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224092
Homologene: 5917
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Tmod3
Name: tropomodulin 3
Synonyms: UTMOD, U-Tmod, ubiquitous tropomodulin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50875
VEGA: 9
Homologene: 8727
Nup54
Name: nucleoporin 54
Synonyms: 3110079L04Rik, 54kDa
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269113
Homologene: 41169
Rrbp1
Name: ribosome binding protein 1
Synonyms: mRRp0, ES/130, p180, mRRp1.8, mRRp2, mRRp5.4, mRRp10, mRRp16.8, mRRp15b, mRRp15a, mRRp41, mRRp47, 5730465C04Rik, 1700087N07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 81910
Homologene: 68138
Ehbp1
Name: EH domain binding protein 1
Synonyms: Flj21950, KIAA0903-like
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216565
Homologene: 22880
Zfp988
Name: zinc finger protein 988
Synonyms: Gm13151
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 115489950
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Trim16
Name: tripartite motif-containing 16
Synonyms: EBBP, 9130006M08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94092
Homologene: 4726
Echdc1
Name: enoyl Coenzyme A hydratase domain containing 1
Synonyms: 1700028A24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52665
Homologene: 23106
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Plcb1
Name: phospholipase C, beta 1
Synonyms: 3110043I21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18795
Homologene: 22876
Dnaaf9
Name: dynein axonemal assembly factor 9
Synonyms: 4930402H24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228602
Homologene: 12623
Duox2
Name: dual oxidase 2
Synonyms: A430065P05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214593
Homologene: 9689
Trmt1l
Name: tRNA methyltransferase 1 like
Synonyms: Trm1-like, 1190005F20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98685
Homologene: 12801
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Tarm1
Name: T cell-interacting, activating receptor on myeloid cells 1
Synonyms: 9930022N03Rik, Gm9904
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 245126
Homologene: 120241
Fam227a
Name: family with sequence similarity 227, member A
Synonyms: 4933432B09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75729
Homologene: 123434
Ppfibp1
Name: PTPRF interacting protein, binding protein 1 (liprin beta 1)
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67533
HGNC: HGNC:9249
Homologene: 2685
Hcls1
Name: hematopoietic cell specific Lyn substrate 1
Synonyms: HS1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15163
HGNC: HGNC:4844
Homologene: 38034
Or4c126
Name: olfactory receptor family 4 subfamily C member 126
Synonyms: GA_x6K02T2Q125-51425355-51426275, MOR234-3, Olfr1261
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258466
Homologene: 138310
Or5w13
Name: olfactory receptor family 5 subfamily W member 13
Synonyms: GA_x6K02T2Q125-49193051-49192119, MOR177-3, Olfr1136
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258653
Homologene: 74193
Erbb2
Name: erb-b2 receptor tyrosine kinase 2
Synonyms: Neu, Neu oncogene, c-erbB2, HER-2, ErbB-2, HER2, c-neu, l11Jus8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13866
HGNC: HGNC:3430
Homologene: 3273
Gys2
Name: glycogen synthase 2
Synonyms: LGS, glycogen synthase, liver
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232493
HGNC: HGNC:4707
Homologene: 56580
Kcnb2
Name: potassium voltage gated channel, Shab-related subfamily, member 2
Synonyms: Kv2.2, 9630047L19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98741
HGNC: HGNC:6232
Homologene: 31263
Vmn1r230
Name: vomeronasal 1 receptor 230
Synonyms: V1re8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171231
Homologene: 136306
Or7d9
Name: olfactory receptor family 7 subfamily D member 9
Synonyms: MOR144-1, GA_x6K02T2PVTD-14025733-14026668, Olfr39
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258822
HGNC: HGNC:8380
Homologene: 81583
Fam98b
Name: family with sequence similarity 98, member B
Synonyms: 2610510H03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68215
Homologene: 72241
Tas2r116
Name: taste receptor, type 2, member 116
Synonyms: TRB4, TRB1, Tas2r7, mt2r56, T2R16, mGR16, Tas2r16, Tas2r14
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 112408
Homologene: 130070
Or4k15
Name: olfactory receptor family 4 subfamily K member 15
Synonyms: GA_x6K02T2PMLR-5817082-5818056, MOR246-2, Olfr727
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258316
Homologene: 84571
Or2h1
Name: olfactory receptor family 2 subfamily H member 1
Synonyms: MOR256-20, GA_x6K02T2PSCP-1533927-1532989, Olfr91
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258470
HGNC: HGNC:8252
Homologene: 72346
Abca7
Name: ATP-binding cassette, sub-family A member 7
Synonyms: Abc51
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27403
HGNC: HGNC:37
Homologene: 22783
Lrriq3
Name: leucine-rich repeats and IQ motif containing 3
Synonyms: 4930511J15Rik, 4930438B07Rik, 4933403H06Rik, Lrrc44
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74435
Homologene: 23668
Zfp977
Name: zinc finger protein 977
Synonyms: Gm7221
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637776
Nans
Name: N-acetylneuraminic acid synthase (sialic acid synthase)
Synonyms: N-acetylneuraminic acid phosphate synthase, Sas, 4632418E04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 94181
Homologene: 10343
Dnaaf6rt
Name: dynein axonemal assembly factor 6, retrotransposed
Synonyms: 4930521A18Rik, Pih1d3, Dnaaf6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74708
Homologene: 16553
Cyp4a30b
Name: cytochrome P450, family 4, subfamily a, polypeptide 30b
Synonyms: OTTMUSG00000008626, Cyp4a30b-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 435802
Ear1
Name: eosinophil-associated, ribonuclease A family, member 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13586
Homologene: 40596
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Psmb11
Name: proteasome (prosome, macropain) subunit, beta type, 11
Synonyms: beta5t, 5830406J20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 73902
VEGA: 14
Homologene: 13729
Trbv14
Name: T cell receptor beta, variable 14
Synonyms: BV13S1, Gm16910, Tcrb-V13
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 100124678
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 15,312,710 bp
  • T to A, chromosome 1 at 31,223,268 bp
  • T to G, chromosome 1 at 151,449,976 bp
  • T to C, chromosome 1 at 179,762,610 bp
  • T to A, chromosome 1 at 188,850,057 bp
  • A to G, chromosome 2 at 10,235,058 bp
  • A to T, chromosome 2 at 71,545,538 bp
  • T to A, chromosome 2 at 77,059,550 bp
  • G to A, chromosome 2 at 82,977,086 bp
  • A to T, chromosome 2 at 87,693,744 bp
  • C to T, chromosome 2 at 89,994,004 bp
  • A to G, chromosome 2 at 117,270,900 bp
  • A to G, chromosome 2 at 121,510,698 bp
  • G to T, chromosome 2 at 122,298,155 bp
  • A to G, chromosome 2 at 130,770,701 bp
  • T to C, chromosome 2 at 135,250,052 bp
  • A to G, chromosome 2 at 143,955,133 bp
  • G to T, chromosome 3 at 104,652,833 bp
  • A to G, chromosome 3 at 155,188,236 bp
  • T to C, chromosome 4 at 46,492,814 bp
  • C to A, chromosome 4 at 99,083,029 bp
  • C to A, chromosome 4 at 115,457,775 bp
  • A to G, chromosome 4 at 147,332,351 bp
  • T to G, chromosome 5 at 92,425,746 bp
  • C to A, chromosome 5 at 104,177,296 bp
  • T to C, chromosome 6 at 4,755,462 bp
  • T to C, chromosome 6 at 41,135,365 bp
  • T to C, chromosome 6 at 132,855,577 bp
  • T to C, chromosome 6 at 142,461,195 bp
  • T to C, chromosome 6 at 147,000,950 bp
  • G to T, chromosome 7 at 3,497,521 bp
  • A to G, chromosome 7 at 42,580,678 bp
  • C to T, chromosome 7 at 139,987,849 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • T to A, chromosome 9 at 20,286,041 bp
  • T to C, chromosome 9 at 75,529,398 bp
  • G to A, chromosome 9 at 108,111,452 bp
  • G to C, chromosome 10 at 29,334,246 bp
  • G to A, chromosome 10 at 76,420,205 bp
  • A to T, chromosome 10 at 80,006,161 bp
  • T to C, chromosome 11 at 22,096,109 bp
  • T to C, chromosome 11 at 62,850,588 bp
  • T to A, chromosome 11 at 70,011,728 bp
  • A to G, chromosome 11 at 98,428,972 bp
  • C to A, chromosome 11 at 120,274,589 bp
  • T to C, chromosome 12 at 65,055,262 bp
  • T to C, chromosome 14 at 43,819,247 bp
  • T to C, chromosome 14 at 50,127,147 bp
  • G to A, chromosome 14 at 54,625,556 bp
  • G to T, chromosome 15 at 7,834,653 bp
  • A to G, chromosome 15 at 25,725,072 bp
  • G to A, chromosome 15 at 79,630,070 bp
  • A to T, chromosome 16 at 30,561,751 bp
  • A to G, chromosome 16 at 36,946,641 bp
  • G to T, chromosome 17 at 20,846,608 bp
  • CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT to CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT, chromosome 17 at 30,760,867 bp
  • A to G, chromosome 17 at 37,093,772 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8439 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067883-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.