Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8462Btlr/Mmmh
Stock Number:
067906-MU
Citation ID:
RRID:MMRRC_067906-MU
Other Names:
R8462 (G1)
Major Collection:

Strain Information

Atrn
Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11990
HGNC: HGNC:885
Homologene: 22542
Colgalt2
Name: collagen beta(1-O)galactosyltransferase 2
Synonyms: Glt25d2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269132
Homologene: 22865
Nsd1
Name: nuclear receptor-binding SET-domain protein 1
Synonyms: KMT3B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18193
VEGA: 13
Homologene: 32543
Klf2
Name: Kruppel-like transcription factor 2 (lung)
Synonyms: Lklf
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16598
HGNC: HGNC:6347
Homologene: 133978
Matk
Name: megakaryocyte-associated tyrosine kinase
Synonyms: Ntk, HYL, CHK, Csk homologous kinase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17179
HGNC: HGNC:6906
Homologene: 48104
Kif1b
Name: kinesin family member 1B
Synonyms: D4Mil1e, Kif1b alpha, Kif1b beta, KIF1Bp130, KIF1Bp204, N-3 kinesin, A530096N05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16561
Homologene: 99835
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Ap2a2
Name: adaptor-related protein complex 2, alpha 2 subunit
Synonyms: alpha-C adaptin, alpha-adaptin C, L25, Adtab, 2410074K14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11772
HGNC: HGNC:562
Homologene: 5335
Ralgapa1
Name: Ral GTPase activating protein, alpha subunit 1
Synonyms: 4930400K19Rik, Tulip1, 2310003F20Rik, Garnl1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56784
VEGA: 12
Homologene: 84805
Naf1
Name: nuclear assembly factor 1 ribonucleoprotein
Synonyms: LOC234344
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234344
Homologene: 128518
Dab1
Name: disabled 1
Synonyms: C630028C02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13131
HGNC: HGNC:2661
Homologene: 32084
Lrrk2
Name: leucine-rich repeat kinase 2
Synonyms: cI-46, LOC381026, 9330188B09Rik, D630001M17Rik, 4921513O20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66725
Homologene: 18982
Stim1
Name: stromal interaction molecule 1
Synonyms: SIM
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20866
Homologene: 20681
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Rps10
Name: ribosomal protein S10
Synonyms: 2210402A09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67097
Homologene: 788
Mrnip
Name: MRN complex interacting protein
Synonyms: 3010026O09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68067
Homologene: 75241
Plekhm2
Name: pleckstrin homology domain containing, family M (with RUN domain) member 2
Synonyms: 2310034J19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69582
Homologene: 19575
Zfp984
Name: zinc finger protein 984
Synonyms: Gm13157
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100041677
Homologene: 133076
Stxbp1
Name: syntaxin binding protein 1
Synonyms: Munc-18a, Sxtbp1, Munc18-1, Unc18h, Rb-sec1, N-sec1, nsec1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20910
Homologene: 2382
Pitpnm1
Name: phosphatidylinositol transfer protein, membrane-associated 1
Synonyms: RdgB, DRES9
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18739
HGNC: HGNC:9003
Homologene: 3608
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Ltbp1
Name: latent transforming growth factor beta binding protein 1
Synonyms: LTBP-1, 9430031G15Rik, b2b1000Clo, Ltbp1L
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268977
HGNC: HGNC:6714
Homologene: 522
Celsr2
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: mfmi1, flamingo, EGFL2, Adgrc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53883
HGNC: HGNC:3231
Homologene: 1078
Stab2
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192188
Homologene: 23022
Cfap58
Name: cilia and flagella associated protein 58
Synonyms: LOC381229, Ccdc147
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381229
VEGA: 19
Homologene: 77312
Abcb11
Name: ATP-binding cassette, sub-family B member 11
Synonyms: PFIC2, ABC16, PGY4, Lith1, sister of P-glycoprotein, Bsep
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Grm3
Name: glutamate receptor, metabotropic 3
Synonyms: mGluR3, 0710001G23Rik, Gprc1c, mGlu3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108069
HGNC: HGNC:4595
Homologene: 651
Egr2
Name: early growth response 2
Synonyms: Krox20, Egr-2, Krox-20, Zfp-25, NGF1-B
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13654
HGNC: HGNC:3239
Homologene: 20123
Krt86
Name: keratin 86
Synonyms: MHb4, Krt2-11, Khb4, Krt2-10
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16679
VEGA: 15
HGNC: HGNC:6463
Homologene: 1717
Rmdn2
Name: regulator of microtubule dynamics 2
Synonyms: Fam82a1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381110
VEGA: 17
Homologene: 71930
Traf6
Name: TNF receptor-associated factor 6
Synonyms: 2310003F17Rik, C630032O20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22034
Homologene: 3395
Chl1
Name: cell adhesion molecule L1-like
Synonyms: CALL, A530023M13Rik, close homolog of L1, LICAM2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12661
HGNC: HGNC:1939
Homologene: 21314
S100a11
Name: S100 calcium binding protein A11
Synonyms: S100c, calgizzarin, cal, Emap1, S100a14
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20195
Homologene: 137318
Sppl2c
Name: signal peptide peptidase 2C
Synonyms: 4933407P14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237958
Homologene: 18491
Meikin
Name: meiotic kinetochore factor
Synonyms: 4930404A10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74847
Homologene: 54900
Dixdc1
Name: DIX domain containing 1
Synonyms: 4930563F16Rik, Ccd1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330938
Homologene: 82369
Vps45
Name: vacuolar protein sorting 45
Synonyms: mVps45
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22365
Homologene: 5250
Bmp5
Name: bone morphogenetic protein 5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12160
HGNC: HGNC:1072
Homologene: 22412
Sh3yl1
Name: Sh3 domain YSC-like 1
Synonyms: YSC84, Ray
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 24057
Homologene: 31662
4930544G11Rik
Name: RIKEN cDNA 4930544G11 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67653
Homologene: 130028
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 152,503,072 bp
  • C to T, chromosome 2 at 32,817,281 bp
  • T to C, chromosome 2 at 69,274,155 bp
  • A to G, chromosome 2 at 76,974,043 bp
  • G to A, chromosome 2 at 101,697,456 bp
  • T to A, chromosome 2 at 130,935,584 bp
  • T to C, chromosome 3 at 93,526,115 bp
  • A to T, chromosome 3 at 96,033,779 bp
  • C to A, chromosome 3 at 108,412,851 bp
  • C to T, chromosome 4 at 104,704,207 bp
  • T to C, chromosome 4 at 141,639,819 bp
  • A to G, chromosome 4 at 147,755,339 bp
  • G to A, chromosome 4 at 149,182,340 bp
  • T to C, chromosome 5 at 9,512,365 bp
  • T to C, chromosome 6 at 65,953,090 bp
  • A to G, chromosome 6 at 103,729,169 bp
  • A to G, chromosome 7 at 102,427,117 bp
  • T to A, chromosome 7 at 141,630,481 bp
  • GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC to GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC, chromosome 8 at 66,860,548 bp
  • A to T, chromosome 8 at 72,319,529 bp
  • G to T, chromosome 9 at 50,710,779 bp
  • A to G, chromosome 9 at 75,839,592 bp
  • T to C, chromosome 9 at 95,867,526 bp
  • T to A, chromosome 10 at 67,538,343 bp
  • C to G, chromosome 10 at 81,262,025 bp
  • T to C, chromosome 10 at 86,967,734 bp
  • A to G, chromosome 11 at 50,199,827 bp
  • T to C, chromosome 11 at 54,399,840 bp
  • G to T, chromosome 11 at 104,186,706 bp
  • T to C, chromosome 12 at 30,942,073 bp
  • T to C, chromosome 12 at 55,676,518 bp
  • T to A, chromosome 13 at 55,298,376 bp
  • T to C, chromosome 15 at 91,731,477 bp
  • T to C, chromosome 15 at 101,479,403 bp
  • A to G, chromosome 17 at 27,634,234 bp
  • A to G, chromosome 17 at 30,656,629 bp
  • T to C, chromosome 17 at 75,313,074 bp
  • C to T, chromosome 17 at 79,670,624 bp
  • A to T, chromosome 19 at 4,105,135 bp
  • T to A, chromosome 19 at 47,983,650 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8462 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067906-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.