Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8463Btlr/Mmmh
Stock Number:
067907-MU
Citation ID:
RRID:MMRRC_067907-MU
Other Names:
R8463 (G1)
Major Collection:

Strain Information

Gjd2
Name: gap junction protein, delta 2
Synonyms: connexin36, Cx36, Gja9
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14617
Homologene: 7734
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Mif4gd
Name: MIF4G domain containing
Synonyms: 1110014L05Rik, 2310075G12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69674
Homologene: 41389
Xpnpep3
Name: X-prolyl aminopeptidase 3, mitochondrial
Synonyms: E430012M05Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 321003
Mybl2
Name: myeloblastosis oncogene-like 2
Synonyms: Bmyb, B-Myb
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17865
HGNC: HGNC:7548
Homologene: 1847
Cnot2
Name: CCR4-NOT transcription complex, subunit 2
Synonyms: 2600016M12Rik, 2810470K03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72068
HGNC: HGNC:7878
Homologene: 40953
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 37,949,841 bp
  • C to T, chromosome 1 at 194,644,046 bp
  • T to C, chromosome 2 at 24,048,824 bp
  • T to A, chromosome 2 at 30,981,805 bp
  • G to A, chromosome 2 at 69,491,906 bp
  • A to G, chromosome 2 at 83,853,457 bp
  • A to T, chromosome 2 at 87,747,093 bp
  • T to A, chromosome 2 at 114,011,572 bp
  • A to T, chromosome 2 at 127,817,433 bp
  • A to T, chromosome 2 at 163,074,718 bp
  • T to C, chromosome 3 at 51,388,927 bp
  • A to G, chromosome 3 at 107,986,356 bp
  • A to T, chromosome 4 at 33,084,375 bp
  • A to T, chromosome 4 at 84,293,371 bp
  • A to G, chromosome 4 at 141,522,279 bp
  • T to C, chromosome 4 at 155,610,158 bp
  • GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG to GCGCGAGGCCGAGAGGCAGG, chromosome 5 at 76,856,954 bp
  • C to A, chromosome 5 at 109,221,474 bp
  • T to C, chromosome 5 at 115,150,224 bp
  • C to CTCA, chromosome 6 at 4,756,453 bp
  • A to G, chromosome 6 at 23,654,802 bp
  • G to T, chromosome 6 at 40,443,980 bp
  • C to A, chromosome 6 at 41,375,125 bp
  • T to A, chromosome 6 at 41,521,805 bp
  • A to T, chromosome 6 at 104,772,619 bp
  • A to G, chromosome 6 at 124,192,209 bp
  • G to A, chromosome 7 at 33,287,657 bp
  • A to T, chromosome 7 at 38,263,175 bp
  • A to G, chromosome 7 at 44,354,181 bp
  • G to T, chromosome 7 at 91,968,233 bp
  • G to A, chromosome 7 at 103,946,627 bp
  • C to T, chromosome 7 at 119,454,331 bp
  • A to G, chromosome 7 at 132,950,081 bp
  • G to A, chromosome 7 at 143,460,587 bp
  • C to A, chromosome 8 at 41,083,234 bp
  • T to C, chromosome 8 at 109,572,798 bp
  • T to C, chromosome 8 at 110,510,921 bp
  • T to A, chromosome 9 at 18,659,139 bp
  • T to A, chromosome 9 at 44,281,612 bp
  • G to T, chromosome 9 at 67,048,230 bp
  • A to T, chromosome 9 at 99,637,822 bp
  • A to G, chromosome 10 at 52,400,800 bp
  • A to T, chromosome 10 at 79,867,563 bp
  • A to G, chromosome 10 at 116,517,331 bp
  • A to G, chromosome 11 at 74,930,060 bp
  • T to A, chromosome 11 at 115,608,498 bp
  • G to A, chromosome 11 at 115,896,793 bp
  • T to C, chromosome 13 at 31,819,923 bp
  • T to C, chromosome 13 at 49,266,605 bp
  • A to G, chromosome 14 at 41,175,626 bp
  • A to G, chromosome 14 at 65,613,562 bp
  • A to G, chromosome 14 at 122,685,114 bp
  • G to T, chromosome 15 at 64,921,025 bp
  • A to G, chromosome 15 at 81,448,471 bp
  • G to A, chromosome 15 at 86,030,214 bp
  • C to A, chromosome 15 at 101,434,625 bp
  • T to C, chromosome 16 at 18,251,175 bp
  • A to T, chromosome 16 at 32,752,401 bp
  • T to C, chromosome 17 at 29,849,729 bp
  • A to T, chromosome 18 at 12,449,839 bp
  • T to G, chromosome 18 at 37,443,234 bp
  • A to G, chromosome 19 at 9,008,749 bp
  • A to G, chromosome 19 at 50,259,810 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8463 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067907-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.