Strain Name:
Stock Number:
Citation ID:
Other Names:
Major Collection:

Strain Information

Name: bone morphogenetic protein 5; endonuclease-mediated mutation 1, Baylor College of Medicine
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: CRISPR
Name: bone morphogenetic protein 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: CRISPR
NCBI: 12160
Homologene: 22412
Genetic Alterations
This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 4 guide sequences CCTTTAACCCTAACTGAATTTCT, CCAGGAATTTGTATAAAACCAGA, CCAAAAGGCTGTTGGTTTGTGGA, CCTTTAACACCTGATATGCATGC, which resulted in an exon deletion.
Genotype Determination
Phenotyping data may be available at
Strain Development
CRISPR guide(s) and Cas9 protein were microinjected or electroporated into C57BL/6NJ zygotes and progeny were screened for the desired mutation. Founders were mated to C57BL/6NJ breeders, and derived N1 progeny were identified by PCR and sequencing. N1 were then mated again to C57BL/6NJ breeders, to generate N2 mice, identified by PCR. N2 or N2F1 heterozygous mutant mice were mated for production of phenotyping cohorts, and N2 or N2F1 heterozygous mice were used for cryopreservation purposes.
Suggested Control Mice
C57BL/6NJ or wild-type from colony
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Arthur Beaudet, Ph.D., Baylor College of Medicine.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Bred to Homozygosity

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

A license from third party patent owner(s) may be required for for-profit entities to use mouse models derived from CRISPR-Cas9 technologies and it is the Users sole responsibility to determine whether such a license is necessary.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068415-MU-RESUS Litter recovered from cryo-archive $2,624.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.