Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8544Btlr/Mmmh
Stock Number:
068509-MU
Citation ID:
RRID:MMRRC_068509-MU
Other Names:
R8544 (G1)
Major Collection:

Strain Information

Tyr
Name: tyrosinase
Synonyms: skc35, Oca1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22173
Homologene: 30969
Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Ngf
Name: nerve growth factor
Synonyms: Ngfb
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18049
HGNC: HGNC:7808
Homologene: 1876
Upf1
Name: UPF1 RNA helicase and ATPase
Synonyms: PNORF-1, B430202H16Rik, Rent1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19704
HGNC: HGNC:9962
Homologene: 2185
Phf12
Name: PHD finger protein 12
Synonyms: PF1, 2410142K10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268448
Homologene: 10841
Adsl
Name: adenylosuccinate lyase
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11564
HGNC: HGNC:291
Homologene: 12
Usp5
Name: ubiquitin specific peptidase 5 (isopeptidase T)
Synonyms: Ucht
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22225
Homologene: 55758
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 20,522,975 bp
  • T to C, chromosome 1 at 58,529,822 bp
  • T to C, chromosome 2 at 25,083,844 bp
  • C to A, chromosome 2 at 30,093,474 bp
  • T to C, chromosome 2 at 37,982,908 bp
  • T to A, chromosome 2 at 58,017,148 bp
  • T to C, chromosome 2 at 89,193,968 bp
  • C to T, chromosome 2 at 118,757,221 bp
  • A to G, chromosome 2 at 118,927,529 bp
  • T to C, chromosome 2 at 157,193,204 bp
  • A to T, chromosome 3 at 89,402,477 bp
  • A to G, chromosome 3 at 93,288,141 bp
  • G to T, chromosome 3 at 102,520,675 bp
  • A to G, chromosome 3 at 116,592,445 bp
  • C to A, chromosome 4 at 11,516,949 bp
  • A to T, chromosome 4 at 48,397,598 bp
  • A to G, chromosome 4 at 58,206,025 bp
  • CCCCCACCTCCACAGACCCCA to CCCCCACCTCCACAGACCCCACCTCCACAGACCCCA, chromosome 4 at 141,466,828 bp
  • G to A, chromosome 6 at 4,008,045 bp
  • T to A, chromosome 6 at 13,187,653 bp
  • T to C, chromosome 6 at 39,344,363 bp
  • G to T, chromosome 6 at 48,597,345 bp
  • C to T, chromosome 6 at 53,819,310 bp
  • T to A, chromosome 6 at 54,522,856 bp
  • A to G, chromosome 6 at 120,198,057 bp
  • A to T, chromosome 6 at 124,823,517 bp
  • A to G, chromosome 6 at 135,233,289 bp
  • T to C, chromosome 7 at 8,908,192 bp
  • A to G, chromosome 7 at 38,221,344 bp
  • T to A, chromosome 7 at 64,224,608 bp
  • T to C, chromosome 7 at 87,492,792 bp
  • A to T, chromosome 7 at 102,973,731 bp
  • A to G, chromosome 7 at 126,781,484 bp
  • A to C, chromosome 8 at 70,337,052 bp
  • A to G, chromosome 8 at 114,488,906 bp
  • G to A, chromosome 8 at 120,553,652 bp
  • A to G, chromosome 8 at 126,970,071 bp
  • A to G, chromosome 9 at 57,131,041 bp
  • C to T, chromosome 9 at 121,778,826 bp
  • T to C, chromosome 9 at 123,577,058 bp
  • G to T, chromosome 10 at 45,153,127 bp
  • A to T, chromosome 10 at 62,750,579 bp
  • A to G, chromosome 10 at 75,750,056 bp
  • T to C, chromosome 10 at 81,119,542 bp
  • A to T, chromosome 10 at 99,124,908 bp
  • A to T, chromosome 10 at 112,456,196 bp
  • C to A, chromosome 11 at 30,219,750 bp
  • A to G, chromosome 11 at 74,831,392 bp
  • A to C, chromosome 11 at 78,027,409 bp
  • A to G, chromosome 11 at 87,611,909 bp
  • C to A, chromosome 11 at 98,982,662 bp
  • A to T, chromosome 11 at 105,971,290 bp
  • T to C, chromosome 12 at 111,485,365 bp
  • A to T, chromosome 12 at 118,868,726 bp
  • A to G, chromosome 13 at 19,632,166 bp
  • G to A, chromosome 13 at 67,317,180 bp
  • A to T, chromosome 13 at 74,734,058 bp
  • A to T, chromosome 14 at 31,163,051 bp
  • A to G, chromosome 14 at 31,268,904 bp
  • A to G, chromosome 14 at 123,371,523 bp
  • C to A, chromosome 15 at 37,425,735 bp
  • A to T, chromosome 15 at 39,878,574 bp
  • C to T, chromosome 15 at 76,110,119 bp
  • G to T, chromosome 15 at 76,443,358 bp
  • G to T, chromosome 15 at 80,948,533 bp
  • T to C, chromosome 17 at 3,163,020 bp
  • A to C, chromosome 17 at 23,345,799 bp
  • A to G, chromosome 17 at 23,742,227 bp
  • T to A, chromosome 17 at 26,974,474 bp
  • C to T, chromosome 17 at 32,392,119 bp
  • G to A, chromosome 18 at 53,411,540 bp
  • T to A, chromosome 18 at 65,625,156 bp
  • T to C, chromosome 18 at 77,254,418 bp
  • A to T, chromosome 19 at 4,084,892 bp
  • T to A, chromosome 19 at 38,524,459 bp
  • G to C, chromosome 19 at 40,376,800 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8544 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068509-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.