Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8544Btlr/Mmmh
Stock Number:
068509-MU
Citation ID:
RRID:MMRRC_068509-MU
Other Names:
R8544 (G1)
Major Collection:

Strain Information

Tyr
Name: tyrosinase
Synonyms: skc35, Oca1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22173
Homologene: 30969
Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Ngf
Name: nerve growth factor
Synonyms: Ngfb
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18049
HGNC: HGNC:7808
Homologene: 1876
Upf1
Name: UPF1 RNA helicase and ATPase
Synonyms: PNORF-1, B430202H16Rik, Rent1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19704
HGNC: HGNC:9962
Homologene: 2185
Phf12
Name: PHD finger protein 12
Synonyms: PF1, 2410142K10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268448
Homologene: 10841
Adsl
Name: adenylosuccinate lyase
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11564
HGNC: HGNC:291
Homologene: 12
Usp5
Name: ubiquitin specific peptidase 5 (isopeptidase T)
Synonyms: Ucht
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22225
Homologene: 55758
Prep
Name: prolyl endopeptidase
Synonyms: prolyl oligopeptidase, D10Wsu136e, Pop
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19072
VEGA: 10
HGNC: HGNC:9358
Homologene: 2042
Zfp532
Name: zinc finger protein 532
Synonyms: C530030I18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 328977
Homologene: 138627
Slc37a3
Name: solute carrier family 37 (glycerol-3-phosphate transporter), member 3
Synonyms: 2610507O21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72144
Homologene: 41740
Trmt13
Name: tRNA methyltransferase 13
Synonyms: A930028L21Rik, 4631408H19Rik, Ccdc76
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229780
Homologene: 6875
Virma
Name: vir like m6A methyltransferase associated
Synonyms: 1110037F02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66185
Homologene: 41043
Gse1
Name: genetic suppressor element 1, coiled-coil protein
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382034
Homologene: 40964
Sacm1l
Name: SAC1 suppressor of actin mutations 1-like (yeast)
Synonyms: Sac1p, SAC1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83493
VEGA: 9
Homologene: 6320
Cabin1
Name: calcineurin binding protein 1
Synonyms: Ppp3in, Cain, A330070M20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 104248
VEGA: 10
Homologene: 49307
Ccar1
Name: cell division cycle and apoptosis regulator 1
Synonyms: 9430036H15Rik, Carp1, 2610511G16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67500
VEGA: 10
Homologene: 10086
Wwox
Name: WW domain-containing oxidoreductase
Synonyms: WOX1, 9030416C10Rik, 5330426P09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 80707
Homologene: 56334
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Map2k2
Name: mitogen-activated protein kinase kinase 2
Synonyms: MEK2, MAP kinase/Erk kinase, Prkmk2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 26396
HGNC: HGNC:6842
Homologene: 48591
Scaf8
Name: SR-related CTD-associated factor 8
Synonyms: A930036P18Rik, A630086M08Rik, Rbm16
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106583
VEGA: 17
Homologene: 8928
Zbtb17
Name: zinc finger and BTB domain containing 17
Synonyms: mZ13, Miz1, Zfp100
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22642
Homologene: 2575
Rbm34
Name: RNA binding motif protein 34
Synonyms: 4930547K05Rik, D8Ertd233e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52202
Homologene: 56691
Galnt5
Name: polypeptide N-acetylgalactosaminyltransferase 5
Synonyms: ppGaNTase-T5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241391
HGNC: HGNC:4127
Homologene: 8733
Sfrp4
Name: secreted frizzled-related protein 4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20379
VEGA: 13
Homologene: 2267
St8sia5
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
Synonyms: ST8SiaV, Siat8e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225742
Homologene: 8331
Chst14
Name: carbohydrate sulfotransferase 14
Synonyms: 2600016L03Rik, D4st1, D4ST-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72136
Homologene: 12443
Rbl1
Name: RB transcriptional corepressor like 1
Synonyms: p107, retinoblastoma-like 1 (p107)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19650
HGNC: HGNC:9893
Homologene: 2172
Mnt
Name: max binding protein
Synonyms: Rox, bHLHd3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17428
HGNC: HGNC:7188
Homologene: 7842
Zdhhc12
Name: zinc finger, DHHC domain containing 12
Synonyms: 1190004A01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66220
Homologene: 11934
Mtmr4
Name: myotubularin related protein 4
Synonyms: ESTM44, FYVE-DSP2, FYVE zinc finger phosphatase, ZFYVE11
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 170749
HGNC: HGNC:7452
Homologene: 3440
Dennd1a
Name: DENN domain containing 1A
Synonyms: 6030446I19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227801
Homologene: 17141
Dnah1
Name: dynein, axonemal, heavy chain 1
Synonyms: MDHC7, E030034C22Rik, B230373P09Rik, Dnahc1, G1-415-19, ferf1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110084
VEGA: 14
HGNC: HGNC:2940
Homologene: 67131
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 4833413O10Rik, D430029O09Rik, 1110021D17Rik, Polydom
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 64817
Homologene: 23386
Lrp12
Name: low density lipoprotein-related protein 12
Synonyms: C820005L12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239393
Homologene: 8385
Trpm1
Name: transient receptor potential cation channel, subfamily M, member 1
Synonyms: Mlsn1, 4732499L03Rik, melastatin, LTRPC1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17364
HGNC: HGNC:7146
Homologene: 19940
Man2c1
Name: mannosidase, alpha, class 2C, member 1
Synonyms: 1110025H24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73744
HGNC: HGNC:6827
Homologene: 4887
Nalcn
Name: sodium leak channel, non-selective
Synonyms: A530023G15Rik, Vgcnl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Vmn2r115
Name: vomeronasal 2, receptor 115
Synonyms: EG638102, V2Rp4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 638102
Homologene: 86604
Tril
Name: TLR4 interactor with leucine-rich repeats
Synonyms: 1200009O22Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66873
Homologene: 69404
Ppic
Name: peptidylprolyl isomerase C
Synonyms: cyclophilin C, CyP-20c
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19038
VEGA: 18
HGNC: HGNC:9256
Homologene: 727
Flg
Name: filaggrin
Synonyms: profilaggrin, fillagrin, ft
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14246
VEGA: 3
Stab1
Name: stabilin 1
Synonyms: MS-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 192187
Homologene: 9035
Kremen2
Name: kringle containing transmembrane protein 2
Synonyms: 2900054E04Rik, Krm2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73016
VEGA: 17
Homologene: 65132
Rasal3
Name: RAS protein activator like 3
Synonyms: A430107D22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320484
Homologene: 18901
Plce1
Name: phospholipase C, epsilon 1
Synonyms: 4933403A21Rik, PLCepsilon
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74055
Homologene: 9478
Mroh1
Name: maestro heat-like repeat family member 1
Synonyms: D330001F17Rik, Heatr7a
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223658
Homologene: 44882
Zfp595
Name: zinc finger protein 595
Synonyms: A230042K10Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218314
Homologene: 120258
Fam234b
Name: family with sequence similarity 234, member B
Synonyms: 8430419L09Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74525
Homologene: 12572
Abcb5
Name: ATP-binding cassette, sub-family B member 5
Synonyms: 9230106F14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 77706
HGNC: HGNC:46
Homologene: 83488
Vwde
Name: von Willebrand factor D and EGF domains
Synonyms: LOC232585
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232585
Homologene: 35456
Kcnc2
Name: potassium voltage gated channel, Shaw-related subfamily, member 2
Synonyms: Kv3.2, KShIIIA
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268345
VEGA: 10
HGNC: HGNC:6234
Homologene: 71199
Repin1
Name: replication initiator 1
Synonyms: AP4, E430037F08Rik, Zfp464
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58887
Homologene: 22810
Ace
Name: angiotensin I converting enzyme
Synonyms: CD143
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11421
HGNC: HGNC:2707
Homologene: 37351
Hycc2
Name: hyccin PI4KA lipid kinase complex subunit 2
Synonyms: D1Ertd53e, Fam126b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213056
Homologene: 18184
Klhl40
Name: kelch-like 40
Synonyms: 2310024D23Rik, Kbtbd5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72330
VEGA: 9
Homologene: 17571
Entpd8
Name: ectonucleoside triphosphate diphosphohydrolase 8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72090
Homologene: 77857
Zbtb9
Name: zinc finger and BTB domain containing 9
Synonyms: 3930402F13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 474156
Homologene: 45145
Plekhf1
Name: pleckstrin homology domain containing, family F (with FYVE domain) member 1
Synonyms: 1810013P09Rik, LAPF
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72287
Homologene: 11516
Poc1b
Name: POC1 centriolar protein B
Synonyms: 4933430F16Rik, Wdr51b
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 382406
Homologene: 41728
Lenep
Name: lens epithelial protein
Synonyms: Lep503
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 57275
Homologene: 10251
Ccdc9b
Name: coiled-coil domain containing 9B
Synonyms: A430105I19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214239
Homologene: 128188
Or4c121
Name: olfactory receptor family 4 subfamily C member 121
Synonyms: GA_x6K02T2Q125-50672630-50671698, MOR233-2, Olfr1226
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258969
Homologene: 27315
Scrn1
Name: secernin 1
Synonyms: 6330535A03Rik, SES1, 2810019K23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69938
Homologene: 8853
Gjd3
Name: gap junction protein, delta 3
Synonyms: Gja11, connexin-30.2, cx30.2, connexin 30.2, Gjc1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 353155
Homologene: 17530
Gm266
Name: predicted gene 266
Synonyms: LOC212539
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 212539
VEGA: 12
Homologene: 19334
Gng11
Name: guanine nucleotide binding protein (G protein), gamma 11
Synonyms: 0610037B21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66066
HGNC: HGNC:4403
Homologene: 3045
Or51g2
Name: olfactory receptor family 51 subfamily G member 2
Synonyms: GA_x6K02T2PBJ9-5685322-5684384, MOR7-2, Olfr577
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259113
Homologene: 64962
Vmn2r40
Name: vomeronasal 2, receptor 40
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042781
Homologene: 113703
Eppk1
Name: epiplakin 1
Synonyms: EPIPL1, EPPK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223650
VEGA: 15
Homologene: 20006
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 20,522,975 bp
  • T to C, chromosome 1 at 58,529,822 bp
  • T to C, chromosome 2 at 25,083,844 bp
  • C to A, chromosome 2 at 30,093,474 bp
  • T to C, chromosome 2 at 37,982,908 bp
  • T to A, chromosome 2 at 58,017,148 bp
  • T to C, chromosome 2 at 89,193,968 bp
  • C to T, chromosome 2 at 118,757,221 bp
  • A to G, chromosome 2 at 118,927,529 bp
  • T to C, chromosome 2 at 157,193,204 bp
  • A to T, chromosome 3 at 89,402,477 bp
  • A to G, chromosome 3 at 93,288,141 bp
  • G to T, chromosome 3 at 102,520,675 bp
  • A to G, chromosome 3 at 116,592,445 bp
  • C to A, chromosome 4 at 11,516,949 bp
  • A to T, chromosome 4 at 48,397,598 bp
  • A to G, chromosome 4 at 58,206,025 bp
  • CCCCCACCTCCACAGACCCCA to CCCCCACCTCCACAGACCCCACCTCCACAGACCCCA, chromosome 4 at 141,466,828 bp
  • G to A, chromosome 6 at 4,008,045 bp
  • T to A, chromosome 6 at 13,187,653 bp
  • T to C, chromosome 6 at 39,344,363 bp
  • G to T, chromosome 6 at 48,597,345 bp
  • C to T, chromosome 6 at 53,819,310 bp
  • T to A, chromosome 6 at 54,522,856 bp
  • A to G, chromosome 6 at 120,198,057 bp
  • A to T, chromosome 6 at 124,823,517 bp
  • A to G, chromosome 6 at 135,233,289 bp
  • T to C, chromosome 7 at 8,908,192 bp
  • A to G, chromosome 7 at 38,221,344 bp
  • T to A, chromosome 7 at 64,224,608 bp
  • T to C, chromosome 7 at 87,492,792 bp
  • A to T, chromosome 7 at 102,973,731 bp
  • A to G, chromosome 7 at 126,781,484 bp
  • A to C, chromosome 8 at 70,337,052 bp
  • A to G, chromosome 8 at 114,488,906 bp
  • G to A, chromosome 8 at 120,553,652 bp
  • A to G, chromosome 8 at 126,970,071 bp
  • A to G, chromosome 9 at 57,131,041 bp
  • C to T, chromosome 9 at 121,778,826 bp
  • T to C, chromosome 9 at 123,577,058 bp
  • G to T, chromosome 10 at 45,153,127 bp
  • A to T, chromosome 10 at 62,750,579 bp
  • A to G, chromosome 10 at 75,750,056 bp
  • T to C, chromosome 10 at 81,119,542 bp
  • A to T, chromosome 10 at 99,124,908 bp
  • A to T, chromosome 10 at 112,456,196 bp
  • C to A, chromosome 11 at 30,219,750 bp
  • A to G, chromosome 11 at 74,831,392 bp
  • A to C, chromosome 11 at 78,027,409 bp
  • A to G, chromosome 11 at 87,611,909 bp
  • C to A, chromosome 11 at 98,982,662 bp
  • A to T, chromosome 11 at 105,971,290 bp
  • T to C, chromosome 12 at 111,485,365 bp
  • A to T, chromosome 12 at 118,868,726 bp
  • A to G, chromosome 13 at 19,632,166 bp
  • G to A, chromosome 13 at 67,317,180 bp
  • A to T, chromosome 13 at 74,734,058 bp
  • A to T, chromosome 14 at 31,163,051 bp
  • A to G, chromosome 14 at 31,268,904 bp
  • A to G, chromosome 14 at 123,371,523 bp
  • C to A, chromosome 15 at 37,425,735 bp
  • A to T, chromosome 15 at 39,878,574 bp
  • C to T, chromosome 15 at 76,110,119 bp
  • G to T, chromosome 15 at 76,443,358 bp
  • G to T, chromosome 15 at 80,948,533 bp
  • T to C, chromosome 17 at 3,163,020 bp
  • A to C, chromosome 17 at 23,345,799 bp
  • A to G, chromosome 17 at 23,742,227 bp
  • T to A, chromosome 17 at 26,974,474 bp
  • C to T, chromosome 17 at 32,392,119 bp
  • G to A, chromosome 18 at 53,411,540 bp
  • T to A, chromosome 18 at 65,625,156 bp
  • T to C, chromosome 18 at 77,254,418 bp
  • A to T, chromosome 19 at 4,084,892 bp
  • T to A, chromosome 19 at 38,524,459 bp
  • G to C, chromosome 19 at 40,376,800 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8544 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068509-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.