Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8545Btlr/Mmmh
Stock Number:
068510-MU
Citation ID:
RRID:MMRRC_068510-MU
Other Names:
R8545 (G1)
Major Collection:

Strain Information

Tet1
Name: tet methylcytosine dioxygenase 1
Synonyms: 2510010B09Rik, D10Ertd17e, Cxxc6, BB001228
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52463
Homologene: 12735
Mad1l1
Name: MAD1 mitotic arrest deficient 1-like 1
Synonyms: Mad1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17120
HGNC: HGNC:6762
Homologene: 74500
Il17rd
Name: interleukin 17 receptor D
Synonyms: Sef, Sef-S, 2810004A10Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 171463
VEGA: 14
Homologene: 9717
Arhgef10
Name: Rho guanine nucleotide exchange factor 10
Synonyms: 6430549H08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234094
Homologene: 22827
Phf3
Name: PHD finger protein 3
Synonyms: 2310061N19Rik, AU020177
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213109
HGNC: HGNC:8921
Homologene: 9040
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Cdc40
Name: cell division cycle 40
Synonyms: PRP17, EHB3, 1200003H23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71713
VEGA: 10
Homologene: 5716
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 30,824,310 bp
  • T to C, chromosome 1 at 171,407,430 bp
  • A to T, chromosome 2 at 110,731,236 bp
  • G to A, chromosome 2 at 114,647,767 bp
  • A to T, chromosome 3 at 154,762,359 bp
  • A to T, chromosome 4 at 115,433,030 bp
  • CCCCCACCTCCACAGACCCCA to CCCCCACCTCCACAGACCCCACCTCCACAGACCCCA, chromosome 4 at 141,466,828 bp
  • G to A, chromosome 5 at 52,819,399 bp
  • A to T, chromosome 5 at 108,341,860 bp
  • A to C, chromosome 5 at 140,300,494 bp
  • A to T, chromosome 6 at 23,654,571 bp
  • T to C, chromosome 7 at 29,004,814 bp
  • T to C, chromosome 7 at 127,885,490 bp
  • T to C, chromosome 7 at 128,080,261 bp
  • A to G, chromosome 7 at 141,752,393 bp
  • T to G, chromosome 8 at 14,928,868 bp
  • A to G, chromosome 8 at 14,975,931 bp
  • T to C, chromosome 8 at 25,955,679 bp
  • T to C, chromosome 8 at 94,086,724 bp
  • T to A, chromosome 9 at 66,371,975 bp
  • A to G, chromosome 10 at 40,847,943 bp
  • A to T, chromosome 10 at 62,812,939 bp
  • T to C, chromosome 11 at 50,359,416 bp
  • T to A, chromosome 11 at 67,202,201 bp
  • A to G, chromosome 11 at 84,345,968 bp
  • A to G, chromosome 11 at 102,840,271 bp
  • G to A, chromosome 12 at 72,556,082 bp
  • T to G, chromosome 14 at 27,091,929 bp
  • T to C, chromosome 14 at 33,078,301 bp
  • T to A, chromosome 14 at 88,469,165 bp
  • T to C, chromosome 16 at 22,834,029 bp
  • T to A, chromosome 16 at 38,603,046 bp
  • A to G, chromosome 17 at 21,819,457 bp
  • A to G, chromosome 17 at 33,920,317 bp
  • G to A, chromosome 18 at 20,034,665 bp
  • A to G, chromosome 18 at 34,317,031 bp
  • G to A, chromosome 19 at 10,874,370 bp
  • G to C, chromosome 19 at 40,376,800 bp
  • A to T, chromosome 19 at 43,739,982 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8545 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068510-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.