Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8555Btlr/Mmmh
Stock Number:
068518-MU
Citation ID:
RRID:MMRRC_068518-MU
Other Names:
R8555 (G1)
Major Collection:

Strain Information

Suz12
Name: SUZ12 polycomb repressive complex 2 subunit
Synonyms: 2610028O16Rik, D11Ertd530e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52615
Homologene: 32256
Ntsr1
Name: neurotensin receptor 1
Synonyms: NT-1R, Ntsr1, NTR-1, NTR1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18216
HGNC: HGNC:8039
Homologene: 68261
Pax2
Name: paired box 2
Synonyms: Pax-2, Opdc
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18504
HGNC: HGNC:8616
Homologene: 2968
Pkp4
Name: plakophilin 4
Synonyms: p0071, Armrp, 5031422I09Rik, 9430019K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227937
HGNC: HGNC:9026
Homologene: 2689
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Grhl2
Name: grainyhead like transcription factor 2
Synonyms: BOM, 0610015A08Rik, Tcfcp2l3, grainyheadlike, clft3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 252973
HGNC: HGNC:2799
Homologene: 32616
Rpa2
Name: replication protein A2
Synonyms: 30-kDa protein, Rf-A2, RPA34
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19891
Homologene: 37712
Gm4924
Name: predicted gene 4924
Synonyms: mIF1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237412
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Sec31a
Name: SEC31 homolog A, COPII coat complex component
Synonyms: 1810024J13Rik, Sec31l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69162
Homologene: 42056
Ccdc88a
Name: coiled coil domain containing 88A
Synonyms: C330012F17Rik, D130005J21Rik, C130096N06Rik, GIV, A430106J12Rik, HkRP1, Girdin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108686
Homologene: 41180
Cyp2c70
Name: cytochrome P450, family 2, subfamily c, polypeptide 70
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226105
Homologene: 120027
Pcdh10
Name: protocadherin 10
Synonyms: 6430703F07Rik, 6430521D13Rik, OL-pc, Olpc
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18526
Homologene: 74967
Or6d14
Name: olfactory receptor family 6 subfamily D member 14
Synonyms: GA_x54KRFPKN04-58190962-58191900, MOR119-1, Olfr214
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258754
Homologene: 133694
Vmn2r110
Name: vomeronasal 2, receptor 110
Synonyms: EG224582
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224582
Homologene: 129678
Vmn2r84
Name: vomeronasal 2, receptor 84
Synonyms: EG625068
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625068
Homologene: 129606
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Mfsd6l
Name: major facilitator superfamily domain containing 6-like
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 215723
Homologene: 17128
Sh3pxd2b
Name: SH3 and PX domains 2B
Synonyms: G431001E03Rik, Fad49, Tks4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268396
Homologene: 27952
Speg
Name: SPEG complex locus
Synonyms: BPEG, SPEGbeta, SPEGalpha, D1Bwg1450e, SPEG, Apeg1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11790
Homologene: 55619
Or14j3
Name: olfactory receptor family 14 subfamily J member 3
Synonyms: MOR218-10, GA_x6K02T2PSCP-2049802-2048870, Olfr114
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258284
Homologene: 133642
Matn2
Name: matrilin 2
Synonyms: Crtm2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17181
VEGA: 15
HGNC: HGNC:6908
Homologene: 20538
Alk
Name: anaplastic lymphoma kinase
Synonyms: Tcrz, CD246
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11682
VEGA: 17
HGNC: HGNC:427
Homologene: 68387
Thsd7b
Name: thrombospondin, type I, domain containing 7B
Synonyms: 1700074E13Rik, D130067I03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210417
Homologene: 18180
Trim5
Name: tripartite motif-containing 5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667823
Homologene: 75345
Zfp709
Name: zinc finger protein 709
Synonyms: GIOT-4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 236193
Homologene: 136795
Vmn2r17
Name: vomeronasal 2, receptor 17
Synonyms: EG384221
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384221
Homologene: 104825
Vmn1r174
Name: vomeronasal 1 receptor 174
Synonyms: V1rd22
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404291
Homologene: 79577
Rftn1
Name: raftlin lipid raft linker 1
Synonyms: 2310015N21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76438
Homologene: 18745
Magee2
Name: MAGE family member E2
Synonyms: Mage-e2, 9630059J11Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 272790
Homologene: 16338
Fbxo4
Name: F-box protein 4
Synonyms: 1700096C12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 106052
Homologene: 8134
Serpinb9g
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9g
Synonyms: ovalbumin, 1600002F03Rik, NK21B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 93806
HGNC: HGNC:8955
Homologene: 69093
Trav5-1
Name: T cell receptor alpha variable 5-1
Synonyms: Trav5-1 T-cell receptor alpha chain V region 5-1, Gm7124
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 633740
Mroh9
Name: maestro heat-like repeat family member 9
Synonyms: Armc11, 4921528O07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78258
Homologene: 123521
Fam181b
Name: family with sequence similarity 181, member B
Synonyms: A830059I20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 58238
Homologene: 32504
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 75,402,264 bp
  • C to A, chromosome 1 at 129,595,454 bp
  • T to C, chromosome 1 at 163,072,026 bp
  • A to T, chromosome 2 at 59,308,035 bp
  • A to G, chromosome 2 at 180,538,677 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • A to T, chromosome 3 at 45,379,595 bp
  • A to G, chromosome 4 at 132,772,170 bp
  • T to C, chromosome 5 at 100,392,414 bp
  • A to G, chromosome 5 at 109,452,944 bp
  • G to T, chromosome 6 at 116,557,328 bp
  • A to T, chromosome 7 at 23,754,545 bp
  • C to T, chromosome 7 at 50,600,262 bp
  • A to T, chromosome 7 at 93,080,088 bp
  • T to C, chromosome 7 at 104,278,123 bp
  • A to G, chromosome 8 at 71,889,632 bp
  • T to C, chromosome 10 at 82,377,390 bp
  • A to G, chromosome 10 at 130,394,231 bp
  • T to C, chromosome 11 at 29,430,169 bp
  • C to T, chromosome 11 at 32,411,469 bp
  • G to A, chromosome 11 at 68,557,072 bp
  • T to C, chromosome 11 at 80,031,991 bp
  • A to T, chromosome 13 at 33,492,813 bp
  • A to C, chromosome 14 at 52,622,819 bp
  • A to T, chromosome 15 at 3,965,791 bp
  • A to G, chromosome 15 at 34,423,805 bp
  • A to G, chromosome 15 at 37,233,263 bp
  • A to G, chromosome 16 at 93,771,810 bp
  • G to A, chromosome 17 at 20,584,356 bp
  • G to T, chromosome 17 at 30,721,110 bp
  • A to G, chromosome 17 at 37,589,649 bp
  • G to T, chromosome 17 at 50,047,380 bp
  • A to T, chromosome 17 at 71,921,874 bp
  • T to C, chromosome 19 at 40,183,901 bp
  • T to C, chromosome 19 at 44,761,689 bp
  • A to T, chromosome X at 104,856,481 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8555 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068518-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.


Title

Text