Strain Name:
C57BL/6J-MtgxR8687Btlr/Mmmh
Stock Number:
068542-MU
Citation ID:
RRID:MMRRC_068542-MU
Other Names:
R8687 (G1)
Major Collection:

Strain Information

Spop
Name: speckle-type BTB/POZ protein
Synonyms: TEF2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20747
Homologene: 68354
Ttc27
Name: tetratricopeptide repeat domain 27
Synonyms: 2610511O17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74196
VEGA: 17
Homologene: 41191
Kif1b
Name: kinesin family member 1B
Synonyms: Kif1b alpha, KIF1Bp130, KIF1Bp204, Kif1b beta, A530096N05Rik, N-3 kinesin, D4Mil1e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16561
Homologene: 99835
Trpc4ap
Name: transient receptor potential cation channel, subfamily C, member 4 associated protein
Synonyms: D2Ertd113e, Trp4-associated protein TAP1, 4833429F06Rik, Trrp4ap
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56407
Homologene: 9224
Stam
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
Synonyms: STAM1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20844
Homologene: 37788
Mical3
Name: microtubule associated monooxygenase, calponin and LIM domain containing 3
Synonyms: C130040D16Rik, MICAL-3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 194401
Homologene: 85288
Cog6
Name: component of oligomeric golgi complex 6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67542
Homologene: 10802
Eva1c
Name: eva-1 homolog C
Synonyms: 1700092M14Rik, Fam176c, 4931408A02Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70967
Homologene: 14383
Itgb1
Name: integrin beta 1 (fibronectin receptor beta)
Synonyms: Gm9863, 4633401G24Rik, CD29, beta1 integrin, Fnrb
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16412
HGNC: HGNC:6153
Homologene: 22999
Eme2
Name: essential meiotic structure-specific endonuclease subunit 2
Synonyms: 2810013J18Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 193838
Homologene: 19180
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Iqch
Name: IQ motif containing H
Synonyms: 4921504K03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78250
Homologene: 11258
Ptpdc1
Name: protein tyrosine phosphatase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218232
VEGA: 13
Homologene: 17576
Slco1a8
Name: solute carrier organic anion transporter family, member 1a8
Synonyms: Gm6614
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 625716
Homologene: 87075
Ttc39a
Name: tetratricopeptide repeat domain 39A
Synonyms: 4922503N01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230603
Homologene: 17739
Naip6
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4A, Birc1f, Naip-rs4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17952
HGNC: HGNC:7634
Homologene: 113589
Rhobtb2
Name: Rho-related BTB domain containing 2
Synonyms: E130206H14Rik, Dbc2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 246710
VEGA: 14
Homologene: 22873
Pnma8a
Name: PNMA family member 8A
Synonyms: 4930488B01Rik, 0710005I19Rik, Pnmal1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71691
Homologene: 10073
Kyat1
Name: kynurenine aminotransferase 1
Synonyms: 2010009K05Rik, Kat1, cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase), KATI, Ccbl1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70266
HGNC: HGNC:1564
Homologene: 37872
Gpr137b
Name: G protein-coupled receptor 137B
Synonyms: Tm7sf1, C80741, 2310041G17Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 83924
VEGA: 13
Homologene: 2454
B3galt4
Name: UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
Synonyms: Gal-T2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 54218
HGNC: HGNC:919
Homologene: 2805
Arhgap45
Name: Rho GTPase activating protein 45
Synonyms: Hmha1, 6330406L22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70719
Homologene: 69120
Tmem102
Name: transmembrane protein 102
Synonyms: Cbap, Tmem102-ps
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380705
Homologene: 86820
Cysrt1
Name: cysteine rich tail 1
Synonyms: 2310002J15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67859
Homologene: 12200
Gm3633
Name: predicted gene 3633
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 118568142
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CCTGCTGCTGCTGCTGCTGCCGCTGCTGCTGCTG to CCTGCCGCTGCTGCTGCTG, chromosome 2 at 14,146,280 bp
  • TGCTGCTGCTGCTGCCGCTGCTGCTGCTG to TGCTGCTGCTGCTG, chromosome 2 at 14,146,285 bp
  • A to G, chromosome 2 at 25,239,387 bp
  • A to G, chromosome 2 at 30,185,747 bp
  • T to C, chromosome 2 at 155,635,250 bp
  • C to T, chromosome 3 at 52,984,917 bp
  • T to C, chromosome 4 at 109,431,579 bp
  • T to A, chromosome 4 at 149,261,163 bp
  • A to G, chromosome 6 at 120,959,477 bp
  • C to T, chromosome 6 at 141,994,265 bp
  • T to G, chromosome 7 at 16,960,595 bp
  • T to C, chromosome 8 at 128,716,216 bp
  • A to T, chromosome 9 at 63,524,785 bp
  • C to T, chromosome 10 at 80,016,787 bp
  • T to C, chromosome 11 at 69,804,615 bp
  • G to A, chromosome 11 at 95,470,511 bp
  • T to C, chromosome 13 at 13,359,406 bp
  • G to A, chromosome 13 at 48,586,660 bp
  • T to A, chromosome 13 at 100,299,128 bp
  • A to T, chromosome 14 at 42,640,691 bp
  • G to A, chromosome 14 at 69,800,655 bp
  • C to G, chromosome 16 at 32,753,930 bp
  • C to A, chromosome 16 at 90,890,545 bp
  • C to T, chromosome 17 at 24,894,839 bp
  • A to G, chromosome 17 at 33,950,845 bp
  • T to A, chromosome 17 at 74,739,684 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8687 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068542-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.