Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8688Btlr/Mmmh
Stock Number:
068543-MU
Citation ID:
RRID:MMRRC_068543-MU
Other Names:
R8688 (G1)
Major Collection:

Strain Information

Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: LOC381367, Nav1.3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20269
Homologene: 56005
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Phf14
Name: PHD finger protein 14
Synonyms: 1110001C23Rik, 4932409F11Rik, 5730446A07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75725
Homologene: 8775
Prdm2
Name: PR domain containing 2, with ZNF domain
Synonyms: Riz, Riz1, LOC381568, E330024L24Rik, 4833427P12Rik, KMT8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110593
HGNC: HGNC:9347
Homologene: 40822
Baz1b
Name: bromodomain adjacent to zinc finger domain, 1B
Synonyms: Wbscr9, WSTF
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22385
HGNC: HGNC:961
Homologene: 22651
2700097O09Rik
Name: RIKEN cDNA 2700097O09 gene
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72658
Homologene: 36458
Cdk5rap2
Name: CDK5 regulatory subunit associated protein 2
Synonyms: 2900018K03Rik, an
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214444
Homologene: 49533
Anapc1
Name: anaphase promoting complex subunit 1
Synonyms: tsg24, Apc1, 2610021O03Rik, Mcpr
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17222
Homologene: 7414
Mdc1
Name: mediator of DNA damage checkpoint 1
Synonyms: NFBD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240087
Homologene: 67092
Bltp1
Name: bridge-like lipid transfer protein family member 1
Synonyms: Tweek, FSA, 4932438A13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229227
Homologene: 52105
Wapl
Name: WAPL cohesin release factor
Synonyms: A530089A20Rik, Wapal
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218914
Homologene: 41002
Tg
Name: thyroglobulin
Synonyms: Tgn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21819
Homologene: 2430
Bdp1
Name: B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms: TFIIIB150, TFIIIB90, TAF3B1, TFC5, Tfnr, G630013P12Rik, B130055N23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544971
Homologene: 34582
Stxbp3
Name: syntaxin binding protein 3
Synonyms: Munc-18c, Stxbp3, Stxbp3a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20912
Homologene: 5260
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: 6720464I07Rik, Solo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Rag1
Name: recombination activating 1
Synonyms: Rag-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19373
HGNC: HGNC:9831
Homologene: 387
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: CRP-[b], CRP-[a], ebnerin, hensin, vomeroglandin, Crpd, MUCLIN, gp300
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Zfp335
Name: zinc finger protein 335
Synonyms: 1810045J01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329559
Homologene: 11129
Ube2s
Name: ubiquitin-conjugating enzyme E2S
Synonyms: E2-EPF, 6720465F12Rik, 0910001J09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77891
Homologene: 56676
Adamtsl1
Name: ADAMTS-like 1
Synonyms: punctin-1, 6720426B09Rik, 5930437A14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77739
Homologene: 64642
Hsd17b11
Name: hydroxysteroid (17-beta) dehydrogenase 11
Synonyms: Pan1b, retSDR2, Dhrs8, 17beta-HSD11
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 114664
Homologene: 69209
Acvr1
Name: activin A receptor, type 1
Synonyms: ActR-I, ALK2, Acvr, Acvrlk2, ActRIA, SKR1, Tsk7L, D330013D15Rik, Alk8, Alk-2, Acvr1a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11477
HGNC: HGNC:171
Homologene: 7
Zfp933
Name: zinc finger protein 933
Synonyms: 2810408P10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242747
Homologene: 138474
Siglech
Name: sialic acid binding Ig-like lectin H
Synonyms: Siglec-H, 6430529G09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233274
HGNC: HGNC:1659
Homologene: 48041
Akr1c18
Name: aldo-keto reductase family 1, member C18
Synonyms: 20alpha-HSD, 20alpha-hydroxysteroid dehydrogenase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105349
Homologene: 128661
Tbccd1
Name: TBCC domain containing 1
Synonyms: 5730478M09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70573
VEGA: 16
Homologene: 32392
Cyp2c66
Name: cytochrome P450, family 2, subfamily c, polypeptide 66
Synonyms: 2010301M18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69888
HGNC: HGNC:2622
Homologene: 133566
Ptprh
Name: protein tyrosine phosphatase receptor type H
Synonyms: SAP-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545902
HGNC: HGNC:9672
Homologene: 37693
H2-M9
Name: histocompatibility 2, M region locus 9
Synonyms: M9
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14997
Homologene: 110792
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Rp1
Name: retinitis pigmentosa 1 (human)
Synonyms: oxygen-regulated protein 1, Orp1, mG145, Dcdc3, Rp1h
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19888
Homologene: 4564
Ltbp2
Name: latent transforming growth factor beta binding protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16997
HGNC: HGNC:6715
Homologene: 369
Gcc1
Name: golgi coiled coil 1
Synonyms: 4932417P04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74375
Homologene: 11567
St8sia2
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
Synonyms: ST8SiaII, Siat8b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20450
Homologene: 4384
Ccdc150
Name: coiled-coil domain containing 150
Synonyms: 4930511H11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78016
Homologene: 15814
Mroh1
Name: maestro heat-like repeat family member 1
Synonyms: D330001F17Rik, Heatr7a
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223658
Homologene: 44882
Vmn2r80
Name: vomeronasal 2, receptor 80
Synonyms: EG624765
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 624765
Homologene: 83483
Ugt2b37
Name: UDP glucuronosyltransferase 2 family, polypeptide B37
Synonyms: 0610033E06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 112417
Homologene: 137225
Ildr2
Name: immunoglobulin-like domain containing receptor 2
Synonyms: 3110063L10Rik, 2810478N18Rik, OTTMUSG00000021748, ENSMUSG00000040612, Dbsm1, D1Ertd471e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100039795
Homologene: 52388
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Phlpp2
Name: PH domain and leucine rich repeat protein phosphatase 2
Synonyms: C130044A18Rik, Phlppl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244650
Homologene: 71015
CK137956
Name: cDNA sequence CK137956
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 635169
Homologene: 57187
Hcls1
Name: hematopoietic cell specific Lyn substrate 1
Synonyms: HS1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15163
HGNC: HGNC:4844
Homologene: 38034
Iftap
Name: intraflagellar transport associated protein
Synonyms: NWC, B230118H07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68170
Homologene: 16348
Arhgef33
Name: Rho guanine nucleotide exchange factor 33
Synonyms: LOC381112, Gm941
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381112
VEGA: 17
Homologene: 55190
Dsel
Name: dermatan sulfate epimerase-like
Synonyms: 9330132E09Rik, DS-epi2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319901
Homologene: 12964
Ivl
Name: involucrin
Synonyms: 1110019C06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16447
HGNC: HGNC:6187
Homologene: 137207
Gpr137b
Name: G protein-coupled receptor 137B
Synonyms: C80741, 2310041G17Rik, Tm7sf1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 83924
VEGA: 13
Homologene: 2454
Nmur2
Name: neuromedin U receptor 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216749
Homologene: 49618
Xrra1
Name: X-ray radiation resistance associated 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 446101
Homologene: 19547
1700018F24Rik
Name: RIKEN cDNA 1700018F24 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69396
Homologene: 86127
Or8b51
Name: olfactory receptor family 8 subfamily B member 51
Synonyms: GA_x6K02T2PVTD-32360710-32359778, MOR168-1, Olfr916
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258780
VEGA: 9
Homologene: 74147
Or4k40
Name: olfactory receptor family 4 subfamily K member 40
Synonyms: GA_x6K02T2Q125-72472405-72471488, MOR248-21, Olfr1286
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277562
Homologene: 73992
Orm1
Name: orosomucoid 1
Synonyms: Agp-2, Agp-1, Orm-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18405
Homologene: 130632
Josd2
Name: Josephin domain containing 2
Synonyms: 1110007C05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66124
Homologene: 26696
Zfp689
Name: zinc finger protein 689
Synonyms: 4933416E05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71131
Homologene: 16318
Gm17078
Name: predicted gene 17078
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 102631639
Homologene: 128452
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 4,346,405 bp
  • A to C, chromosome 1 at 54,367,973 bp
  • A to T, chromosome 1 at 111,862,738 bp
  • A to T, chromosome 1 at 166,269,533 bp
  • G to A, chromosome 2 at 58,462,949 bp
  • A to G, chromosome 2 at 65,525,703 bp
  • T to C, chromosome 2 at 101,610,571 bp
  • A to T, chromosome 2 at 101,642,623 bp
  • C to T, chromosome 2 at 111,420,613 bp
  • T to G, chromosome 2 at 128,685,828 bp
  • A to G, chromosome 2 at 164,892,193 bp
  • AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG to AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG, chromosome 2 at 180,595,057 bp
  • T to A, chromosome 3 at 37,035,917 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG, chromosome 3 at 92,572,301 bp
  • A to G, chromosome 3 at 108,802,109 bp
  • G to A, chromosome 4 at 63,346,341 bp
  • A to G, chromosome 4 at 70,380,273 bp
  • A to C, chromosome 4 at 86,248,026 bp
  • C to T, chromosome 4 at 127,950,946 bp
  • T to C, chromosome 4 at 143,111,740 bp
  • T to A, chromosome 4 at 147,826,792 bp
  • T to C, chromosome 5 at 87,242,381 bp
  • T to A, chromosome 5 at 104,021,718 bp
  • A to G, chromosome 5 at 110,720,819 bp
  • T to G, chromosome 5 at 135,242,489 bp
  • C to T, chromosome 5 at 145,045,373 bp
  • A to G, chromosome 6 at 11,990,035 bp
  • A to T, chromosome 6 at 28,418,740 bp
  • T to A, chromosome 7 at 4,551,023 bp
  • C to T, chromosome 7 at 4,810,578 bp
  • T to C, chromosome 7 at 44,471,216 bp
  • A to G, chromosome 7 at 55,768,614 bp
  • A to T, chromosome 7 at 73,943,344 bp
  • A to G, chromosome 7 at 99,906,545 bp
  • C to A, chromosome 7 at 127,444,912 bp
  • T to A, chromosome 7 at 131,058,254 bp
  • A to G, chromosome 8 at 109,904,380 bp
  • T to A, chromosome 9 at 38,657,751 bp
  • A to G, chromosome 10 at 79,168,235 bp
  • A to G, chromosome 10 at 119,999,904 bp
  • T to C, chromosome 11 at 56,040,828 bp
  • T to C, chromosome 11 at 59,056,083 bp
  • T to C, chromosome 11 at 77,785,579 bp
  • C to T, chromosome 12 at 55,057,351 bp
  • T to A, chromosome 12 at 84,803,804 bp
  • T to C, chromosome 13 at 4,137,195 bp
  • T to C, chromosome 13 at 13,359,406 bp
  • T to C, chromosome 13 at 100,103,799 bp
  • T to A, chromosome 14 at 34,692,592 bp
  • T to A, chromosome 14 at 51,611,230 bp
  • T to A, chromosome 15 at 27,748,238 bp
  • T to A, chromosome 15 at 66,694,953 bp
  • A to G, chromosome 15 at 76,428,350 bp
  • A to T, chromosome 16 at 22,822,458 bp
  • T to C, chromosome 16 at 36,961,459 bp
  • A to G, chromosome 17 at 35,850,491 bp
  • A to T, chromosome 17 at 36,642,142 bp
  • A to G, chromosome 17 at 80,373,186 bp
  • A to T, chromosome 19 at 39,163,440 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8688 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068543-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.