Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8710Btlr/Mmmh
Stock Number:
068564-MU
Citation ID:
RRID:MMRRC_068564-MU
Other Names:
R8710 (G1)
Major Collection:

Strain Information

Pald1
Name: phosphatase domain containing, paladin 1
Synonyms: paladin, X99384
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27355
VEGA: 10
Homologene: 8453
Elavl3
Name: ELAV like RNA binding protein 3
Synonyms: mHuC, Huc, 2600009P04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15571
VEGA: 9
HGNC: HGNC:3314
Homologene: 31035
Agpat5
Name: 1-acylglycerol-3-phosphate O-acyltransferase 5
Synonyms: 1110013A05Rik, D8Ertd319e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52123
Homologene: 10153
Slco1a5
Name: solute carrier organic anion transporter family, member 1a5
Synonyms: Oatp3, Slc21a7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108096
Homologene: 56603
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Tjp2
Name: tight junction protein 2
Synonyms: ZO-2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21873
VEGA: 19
Homologene: 3541
Cadm1
Name: cell adhesion molecule 1
Synonyms: 3100001I08Rik, 2900073G06Rik, RA175N, RA175C, RA175B, RA175A, Necl2, SgIGSF, Tslc1, SynCam, Igsf4, Igsf4a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54725
HGNC: HGNC:5951
Homologene: 8641
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 65,215,996 bp
  • A to G, chromosome 1 at 75,492,682 bp
  • C to A, chromosome 1 at 131,058,711 bp
  • T to C, chromosome 1 at 181,690,311 bp
  • A to C, chromosome 1 at 185,295,586 bp
  • C to A, chromosome 1 at 191,063,223 bp
  • A to G, chromosome 2 at 4,763,114 bp
  • G to T, chromosome 2 at 30,827,060 bp
  • G to A, chromosome 2 at 33,145,421 bp
  • A to G, chromosome 2 at 155,829,722 bp
  • ACTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTACTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACA to ACTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTACTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACA, chromosome 3 at 92,737,890 bp
  • A to T, chromosome 3 at 116,497,654 bp
  • A to T, chromosome 4 at 113,626,590 bp
  • A to G, chromosome 4 at 114,194,754 bp
  • A to G, chromosome 5 at 8,955,495 bp
  • C to T, chromosome 5 at 35,873,174 bp
  • A to C, chromosome 5 at 38,774,597 bp
  • A to G, chromosome 5 at 44,194,401 bp
  • G to T, chromosome 5 at 101,882,483 bp
  • T to G, chromosome 5 at 106,635,131 bp
  • A to T, chromosome 5 at 120,662,937 bp
  • T to A, chromosome 5 at 120,791,962 bp
  • A to T, chromosome 6 at 6,114,238 bp
  • A to G, chromosome 6 at 42,264,087 bp
  • A to G, chromosome 6 at 54,622,260 bp
  • G to A, chromosome 6 at 124,908,445 bp
  • A to T, chromosome 6 at 129,269,610 bp
  • A to T, chromosome 6 at 142,253,102 bp
  • G to T, chromosome 7 at 3,675,464 bp
  • T to G, chromosome 7 at 51,593,671 bp
  • T to C, chromosome 7 at 81,023,573 bp
  • T to C, chromosome 7 at 128,265,794 bp
  • A to G, chromosome 7 at 133,643,766 bp
  • T to A, chromosome 8 at 18,878,089 bp
  • A to G, chromosome 8 at 64,124,906 bp
  • C to T, chromosome 8 at 87,780,921 bp
  • A to G, chromosome 8 at 88,709,895 bp
  • A to T, chromosome 9 at 22,026,553 bp
  • C to T, chromosome 9 at 38,209,770 bp
  • T to A, chromosome 9 at 39,238,010 bp
  • T to A, chromosome 9 at 45,867,450 bp
  • T to A, chromosome 9 at 47,848,168 bp
  • A to T, chromosome 9 at 96,002,232 bp
  • T to A, chromosome 10 at 8,780,521 bp
  • A to G, chromosome 10 at 51,725,405 bp
  • A to G, chromosome 10 at 61,347,453 bp
  • T to C, chromosome 10 at 107,576,058 bp
  • A to G, chromosome 10 at 120,105,967 bp
  • C to A, chromosome 11 at 21,660,924 bp
  • A to G, chromosome 11 at 67,252,332 bp
  • G to A, chromosome 11 at 73,954,868 bp
  • A to G, chromosome 11 at 114,894,675 bp
  • A to C, chromosome 11 at 118,042,147 bp
  • A to G, chromosome 11 at 120,284,127 bp
  • T to G, chromosome 13 at 95,660,248 bp
  • T to C, chromosome 14 at 66,307,918 bp
  • A to G, chromosome 15 at 10,539,935 bp
  • T to A, chromosome 15 at 39,084,426 bp
  • A to G, chromosome 15 at 84,018,648 bp
  • A to C, chromosome 16 at 4,958,112 bp
  • T to A, chromosome 16 at 89,508,120 bp
  • A to T, chromosome 17 at 14,988,932 bp
  • A to T, chromosome 17 at 21,661,318 bp
  • T to A, chromosome 17 at 26,920,906 bp
  • G to T, chromosome 17 at 37,574,649 bp
  • T to C, chromosome 17 at 85,113,849 bp
  • A to G, chromosome 17 at 94,733,644 bp
  • T to A, chromosome 18 at 34,749,613 bp
  • G to T, chromosome 19 at 4,263,805 bp
  • T to C, chromosome 19 at 8,818,496 bp
  • T to C, chromosome 19 at 24,095,432 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8710 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068564-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.