Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8743Btlr/Mmmh
Stock Number:
068588-MU
Citation ID:
RRID:MMRRC_068588-MU
Other Names:
R8743 (G1)
Major Collection:

Strain Information

Ccr2
Name: C-C motif chemokine receptor 2
Synonyms: CC-CKR-2, CKR2B, CKR2A, CCR2B, CCR2A, CKR2, Cmkbr2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12772
HGNC: HGNC:1603
Homologene: 537
Nucb2
Name: nucleobindin 2
Synonyms: NEFA, Calnuc, nesfatin-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53322
HGNC: HGNC:8044
Homologene: 3676
Galnt10
Name: polypeptide N-acetylgalactosaminyltransferase 10
Synonyms: GalNAc-T10, Galnt9, C330012K04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171212
Homologene: 14924
Lcmt1
Name: leucine carboxyl methyltransferase 1
Synonyms: Lcmt, LCMT-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 30949
Homologene: 41123
Dusp16
Name: dual specificity phosphatase 16
Synonyms: MKP-7, MKP7, 3830417M17Rik, D6Ertd213e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70686
Homologene: 15604
Psme4
Name: proteasome (prosome, macropain) activator subunit 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103554
Homologene: 113742
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to G, chromosome 1 at 90,767,606 bp
  • A to G, chromosome 1 at 127,774,283 bp
  • G to A, chromosome 1 at 135,831,195 bp
  • T to C, chromosome 1 at 136,105,548 bp
  • A to T, chromosome 1 at 140,118,585 bp
  • A to G, chromosome 2 at 30,083,306 bp
  • A to T, chromosome 2 at 43,748,864 bp
  • T to C, chromosome 2 at 111,169,672 bp
  • A to G, chromosome 2 at 130,143,498 bp
  • G to A, chromosome 3 at 5,244,024 bp
  • C to T, chromosome 3 at 19,157,536 bp
  • G to A, chromosome 3 at 38,888,443 bp
  • A to T, chromosome 3 at 64,409,826 bp
  • CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC to CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC, chromosome 3 at 92,317,519 bp
  • C to A, chromosome 3 at 108,080,116 bp
  • A to G, chromosome 4 at 42,971,030 bp
  • T to A, chromosome 4 at 152,366,405 bp
  • A to G, chromosome 5 at 14,714,566 bp
  • T to A, chromosome 5 at 32,924,243 bp
  • T to A, chromosome 5 at 33,997,166 bp
  • T to A, chromosome 5 at 34,420,157 bp
  • T to C, chromosome 5 at 35,280,448 bp
  • A to T, chromosome 5 at 89,443,452 bp
  • A to G, chromosome 6 at 30,642,993 bp
  • A to T, chromosome 6 at 100,787,323 bp
  • A to T, chromosome 6 at 134,717,970 bp
  • A to T, chromosome 6 at 141,819,529 bp
  • T to A, chromosome 7 at 4,757,815 bp
  • T to C, chromosome 7 at 23,418,747 bp
  • G to A, chromosome 7 at 28,987,117 bp
  • C to T, chromosome 7 at 34,125,554 bp
  • A to G, chromosome 7 at 105,408,013 bp
  • A to G, chromosome 7 at 116,528,830 bp
  • T to A, chromosome 7 at 123,400,468 bp
  • A to T, chromosome 8 at 13,393,489 bp
  • A to G, chromosome 8 at 22,939,006 bp
  • A to T, chromosome 8 at 24,786,248 bp
  • A to G, chromosome 8 at 76,909,758 bp
  • A to G, chromosome 8 at 109,837,791 bp
  • G to T, chromosome 9 at 37,746,878 bp
  • A to T, chromosome 9 at 38,827,699 bp
  • A to T, chromosome 9 at 62,060,821 bp
  • A to T, chromosome 9 at 82,927,087 bp
  • G to A, chromosome 9 at 90,195,243 bp
  • A to G, chromosome 9 at 106,212,811 bp
  • A to C, chromosome 9 at 124,106,094 bp
  • A to T, chromosome 10 at 23,941,471 bp
  • C to T, chromosome 10 at 40,841,484 bp
  • C to A, chromosome 10 at 61,660,979 bp
  • A to G, chromosome 10 at 75,439,876 bp
  • T to G, chromosome 11 at 30,878,467 bp
  • G to T, chromosome 11 at 34,273,252 bp
  • T to C, chromosome 11 at 40,708,031 bp
  • A to G, chromosome 11 at 57,784,583 bp
  • T to G, chromosome 11 at 61,342,762 bp
  • A to G, chromosome 11 at 67,722,075 bp
  • T to C, chromosome 11 at 74,930,033 bp
  • T to A, chromosome 11 at 77,466,439 bp
  • A to G, chromosome 12 at 83,782,990 bp
  • A to T, chromosome 13 at 33,494,948 bp
  • A to C, chromosome 13 at 64,062,898 bp
  • C to A, chromosome 13 at 76,066,809 bp
  • C to T, chromosome 15 at 96,415,788 bp
  • A to C, chromosome 16 at 23,613,116 bp
  • G to T, chromosome 16 at 34,921,057 bp
  • C to CA, chromosome 17 at 6,084,558 bp
  • T to C, chromosome 17 at 80,360,453 bp
  • T to C, chromosome 18 at 10,572,123 bp
  • T to A, chromosome 18 at 36,994,319 bp
  • A to C, chromosome 19 at 17,119,556 bp
  • A to T, chromosome 19 at 21,400,588 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8743 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068588-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.