Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8743Btlr/Mmmh
Stock Number:
068588-MU
Citation ID:
RRID:MMRRC_068588-MU
Other Names:
R8743 (G1)
Major Collection:

Strain Information

Ccr2
Name: C-C motif chemokine receptor 2
Synonyms: CC-CKR-2, CKR2B, CKR2A, CCR2B, CCR2A, CKR2, Cmkbr2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12772
HGNC: HGNC:1603
Homologene: 537
Nucb2
Name: nucleobindin 2
Synonyms: NEFA, Calnuc, nesfatin-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53322
HGNC: HGNC:8044
Homologene: 3676
Galnt10
Name: polypeptide N-acetylgalactosaminyltransferase 10
Synonyms: GalNAc-T10, Galnt9, C330012K04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171212
Homologene: 14924
Lcmt1
Name: leucine carboxyl methyltransferase 1
Synonyms: Lcmt, LCMT-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 30949
Homologene: 41123
Dusp16
Name: dual specificity phosphatase 16
Synonyms: MKP-7, MKP7, 3830417M17Rik, D6Ertd213e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70686
Homologene: 15604
Psme4
Name: proteasome (prosome, macropain) activator subunit 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103554
Homologene: 113742
Armc1
Name: armadillo repeat containing 1
Synonyms: 2900046P06Rik, C330014L16Rik, 2310016N05Rik, 3110009G21Rik, Arcp
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74252
Homologene: 10015
Hmmr
Name: hyaluronan mediated motility receptor (RHAMM)
Synonyms: CD168, Rhamm
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15366
HGNC: HGNC:5012
Homologene: 8271
Cdc40
Name: cell division cycle 40
Synonyms: PRP17, EHB3, 1200003H23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71713
VEGA: 10
Homologene: 5716
Phip
Name: pleckstrin homology domain interacting protein
Synonyms: Wdr11, Ndrp, 2810004D21Rik, 4632404O06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83946
Homologene: 41209
Smg6
Name: SMG6 nonsense mediated mRNA decay factor
Synonyms: Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103677
Homologene: 23024
Ap1g1
Name: adaptor protein complex AP-1, gamma 1 subunit
Synonyms: gamma-adaptin, Adtg, D8Ertd374e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11765
HGNC: HGNC:555
Homologene: 47995
Adra2c
Name: adrenergic receptor, alpha 2c
Synonyms: alpha2-C4, subtype alpha2-C4, [a]2C, alpha2C, Adra-2c
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11553
HGNC: HGNC:283
Homologene: 20170
Wtip
Name: WT1 interacting protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101543
Homologene: 64353
Fam193a
Name: family with sequence homology 193, member A
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231128
Homologene: 2746
Prune2
Name: prune homolog 2
Synonyms: 6330414G02Rik, A330102H22Rik, A230083H22Rik, Olfaxin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Gda
Name: guanine deaminase
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14544
HGNC: HGNC:4212
Homologene: 3171
Ampd2
Name: adenosine monophosphate deaminase 2
Synonyms: Ampd-2, 1200014F01Rik, m4521Dajl
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109674
HGNC: HGNC:469
Homologene: 2979
Ppa1
Name: pyrophosphatase (inorganic) 1
Synonyms: 2010317E03Rik, Pyp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67895
HGNC: HGNC:9226
Homologene: 5356
Twf2
Name: twinfilin actin binding protein 2
Synonyms: A6-related, Twf2, Twinfilin-2, Ptk9l
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 23999
HGNC: HGNC:9621
Homologene: 5272
Esco1
Name: establishment of sister chromatid cohesion N-acetyltransferase 1
Synonyms: A930014I12Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 77805
Homologene: 62166
Kat6a
Name: K(lysine) acetyltransferase 6A
Synonyms: MOZ, Zfp220, 9930021N24Rik, Myst3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244349
Homologene: 4924
Papln
Name: papilin, proteoglycan-like sulfated glycoprotein
Synonyms: E030033C16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 170721
Homologene: 71541
Dock2
Name: dedicator of cyto-kinesis 2
Synonyms: MBC, CED-5, Hch
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94176
HGNC: HGNC:2988
Homologene: 37984
Ccnt2
Name: cyclin T2
Synonyms: 2900041I18Rik, CycT2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72949
HGNC: HGNC:1600
Homologene: 14043
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: Zfh-4, C130041O22Rik, Zfh4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80892
Homologene: 23477
Map4k1
Name: mitogen-activated protein kinase kinase kinase kinase 1
Synonyms: Hpk1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26411
HGNC: HGNC:6863
Homologene: 5199
Nr3c2
Name: nuclear receptor subfamily 3, group C, member 2
Synonyms: aldosterone receptor, Mlr, MR, mineralocorticoid receptor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 110784
HGNC: HGNC:7979
Homologene: 121495
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Cpa1
Name: carboxypeptidase A1, pancreatic
Synonyms: 0910001L12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109697
HGNC: HGNC:2296
Homologene: 55609
Glce
Name: glucuronyl C5-epimerase
Synonyms: heparan sulfate-glucuronic acid C5-epimerase, Hsepi, C130034A12Rik, 1110017N23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 93683
Homologene: 14111
Glp2r
Name: glucagon-like peptide 2 receptor
Synonyms: GLP-2, 9530092J08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 93896
HGNC: HGNC:4325
Homologene: 3132
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Cnga4
Name: cyclic nucleotide gated channel alpha 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233649
HGNC: HGNC:2152
Homologene: 13579
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: fmd, mdg, Cchl1a3, sj, muscle dysgenesis, Cav1.1, DHPR alpha1s
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Spata31g1
Name: SPATA31 subfamily G member 1
Synonyms: 1700022I11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67317
Homologene: 52406
Adamts7
Name: ADAM metallopeptidase with thrombospondin type 1 motif 7
Synonyms: ADAM-TS7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108153
HGNC: HGNC:223
Homologene: 22803
Taar2
Name: trace amine-associated receptor 2
Synonyms: Gpr58
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 209512
HGNC: HGNC:4514
Homologene: 110760
Gxylt2
Name: glucoside xylosyltransferase 2
Synonyms: LOC232313, Glt8d4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232313
Homologene: 16823
Slc47a2
Name: solute carrier family 47, member 2
Synonyms: 4933429E10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380701
Homologene: 134426
Rtp4
Name: receptor transporter protein 4
Synonyms: 5830458K16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67775
Homologene: 56944
Slco1a4
Name: solute carrier organic anion transporter family, member 1a4
Synonyms: Oatp2, Slc21a5, Oatp1a4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28250
Homologene: 130782
Chd5
Name: chromodomain helicase DNA binding protein 5
Synonyms: B230399N07Rik, 4930532L22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269610
Homologene: 56712
Adam5
Name: a disintegrin and metallopeptidase domain 5
Synonyms: tMDCII
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11499
HGNC: HGNC:212
Homologene: 49138
Or8b56
Name: olfactory receptor family 8 subfamily B member 56
Synonyms: GA_x6K02T2PVTD-32530445-32531380, MOR164-2, Olfr923
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258812
VEGA: 9
Hsd17b3
Name: hydroxysteroid (17-beta) dehydrogenase 3
Synonyms: 17(beta)HSD type 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15487
VEGA: 13
HGNC: HGNC:5212
Homologene: 20089
Mylk
Name: myosin, light polypeptide kinase
Synonyms: telokin, Mlck, MLCK210, MLCK108, 9530072E15Rik, A930019C19Rik, nmMlck
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 107589
HGNC: HGNC:7590
Homologene: 14202
Arhgap15
Name: Rho GTPase activating protein 15
Synonyms: 5830480G12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76117
Homologene: 41271
Garin5b
Name: golgi associated RAB2 interactor family member 5B
Synonyms: 4930401F20Rik, Fam71e2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243822
Homologene: 89225
Scaf11
Name: SR-related CTD-associated factor 11
Synonyms: 1110061H03Rik, SRRP129, CASP11, SIP1, 2610510E10Rik, Sfrs2ip, Srsf2ip
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72193
VEGA: 15
Homologene: 37957
Arhgef33
Name: Rho guanine nucleotide exchange factor 33
Synonyms: LOC381112, Gm941
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381112
VEGA: 17
Homologene: 55190
Tgm6
Name: transglutaminase 6
Synonyms: TGM3L
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241636
Homologene: 27970
Cfh
Name: complement component factor h
Synonyms: Sas-1, Mud-1, Sas1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Arsk
Name: arylsulfatase K
Synonyms: 4833414G15Rik, 2810429K17Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 77041
Homologene: 12670
Pkn3
Name: protein kinase N3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 263803
Homologene: 50980
Vmn2r4
Name: vomeronasal 2, receptor 4
Synonyms: EG637053
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 637053
Homologene: 129754
Nlrp5
Name: NLR family, pyrin domain containing 5
Synonyms: Op1, Mater, Nalp5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23968
Homologene: 65105
Upb1
Name: ureidopropionase, beta
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103149
Homologene: 9471
Or8b12
Name: olfactory receptor family 8 subfamily B member 12
Synonyms: GA_x6K02T2PVTD-31428850-31429782, MOR161-2, Olfr874
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258882
Homologene: 17377
Atp4b
Name: ATPase, H+/K+ exchanging, beta polypeptide
Synonyms: H+,K+-ATPase, H,K-ATPase-Beta, H+/K+-ATPase beta
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11945
HGNC: HGNC:820
Homologene: 20182
Gc
Name: vitamin D binding protein
Synonyms: DBP, vitamin D binding protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14473
HGNC: HGNC:4187
Homologene: 486
Nat8l
Name: N-acetyltransferase 8-like
Synonyms: 1110038O08Rik, Shati
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269642
Homologene: 19546
Serpinb9g
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9g
Synonyms: 1600002F03Rik, NK21B, ovalbumin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 93806
HGNC: HGNC:8955
Homologene: 69093
Gtf2h5
Name: general transcription factor IIH, polypeptide 5
Synonyms: 2700017P07Rik, 2810432H05Rik, D17Wsu155e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66467
Homologene: 45635
Pcdha8
Name: protocadherin alpha 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 353235
HGNC: HGNC:8675
Homologene: 129614
Sprr2b
Name: small proline-rich protein 2B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20756
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to G, chromosome 1 at 90,767,606 bp
  • A to G, chromosome 1 at 127,774,283 bp
  • G to A, chromosome 1 at 135,831,195 bp
  • T to C, chromosome 1 at 136,105,548 bp
  • A to T, chromosome 1 at 140,118,585 bp
  • A to G, chromosome 2 at 30,083,306 bp
  • A to T, chromosome 2 at 43,748,864 bp
  • T to C, chromosome 2 at 111,169,672 bp
  • A to G, chromosome 2 at 130,143,498 bp
  • G to A, chromosome 3 at 5,244,024 bp
  • C to T, chromosome 3 at 19,157,536 bp
  • G to A, chromosome 3 at 38,888,443 bp
  • A to T, chromosome 3 at 64,409,826 bp
  • CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC to CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC, chromosome 3 at 92,317,519 bp
  • C to A, chromosome 3 at 108,080,116 bp
  • A to G, chromosome 4 at 42,971,030 bp
  • T to A, chromosome 4 at 152,366,405 bp
  • A to G, chromosome 5 at 14,714,566 bp
  • T to A, chromosome 5 at 32,924,243 bp
  • T to A, chromosome 5 at 33,997,166 bp
  • T to A, chromosome 5 at 34,420,157 bp
  • T to C, chromosome 5 at 35,280,448 bp
  • A to T, chromosome 5 at 89,443,452 bp
  • A to G, chromosome 6 at 30,642,993 bp
  • A to T, chromosome 6 at 100,787,323 bp
  • A to T, chromosome 6 at 134,717,970 bp
  • A to T, chromosome 6 at 141,819,529 bp
  • T to A, chromosome 7 at 4,757,815 bp
  • T to C, chromosome 7 at 23,418,747 bp
  • G to A, chromosome 7 at 28,987,117 bp
  • C to T, chromosome 7 at 34,125,554 bp
  • A to G, chromosome 7 at 105,408,013 bp
  • A to G, chromosome 7 at 116,528,830 bp
  • T to A, chromosome 7 at 123,400,468 bp
  • A to T, chromosome 8 at 13,393,489 bp
  • A to G, chromosome 8 at 22,939,006 bp
  • A to T, chromosome 8 at 24,786,248 bp
  • A to G, chromosome 8 at 76,909,758 bp
  • A to G, chromosome 8 at 109,837,791 bp
  • G to T, chromosome 9 at 37,746,878 bp
  • A to T, chromosome 9 at 38,827,699 bp
  • A to T, chromosome 9 at 62,060,821 bp
  • A to T, chromosome 9 at 82,927,087 bp
  • G to A, chromosome 9 at 90,195,243 bp
  • A to G, chromosome 9 at 106,212,811 bp
  • A to C, chromosome 9 at 124,106,094 bp
  • A to T, chromosome 10 at 23,941,471 bp
  • C to T, chromosome 10 at 40,841,484 bp
  • C to A, chromosome 10 at 61,660,979 bp
  • A to G, chromosome 10 at 75,439,876 bp
  • T to G, chromosome 11 at 30,878,467 bp
  • G to T, chromosome 11 at 34,273,252 bp
  • T to C, chromosome 11 at 40,708,031 bp
  • A to G, chromosome 11 at 57,784,583 bp
  • T to G, chromosome 11 at 61,342,762 bp
  • A to G, chromosome 11 at 67,722,075 bp
  • T to C, chromosome 11 at 74,930,033 bp
  • T to A, chromosome 11 at 77,466,439 bp
  • A to G, chromosome 12 at 83,782,990 bp
  • A to T, chromosome 13 at 33,494,948 bp
  • A to C, chromosome 13 at 64,062,898 bp
  • C to A, chromosome 13 at 76,066,809 bp
  • C to T, chromosome 15 at 96,415,788 bp
  • A to C, chromosome 16 at 23,613,116 bp
  • G to T, chromosome 16 at 34,921,057 bp
  • C to CA, chromosome 17 at 6,084,558 bp
  • T to C, chromosome 17 at 80,360,453 bp
  • T to C, chromosome 18 at 10,572,123 bp
  • T to A, chromosome 18 at 36,994,319 bp
  • A to C, chromosome 19 at 17,119,556 bp
  • A to T, chromosome 19 at 21,400,588 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8743 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068588-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.