Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8788Btlr/Mmmh
Stock Number:
068607-MU
Citation ID:
RRID:MMRRC_068607-MU
Other Names:
R8788 (G1)
Major Collection:

Strain Information

Smarca4
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Synonyms: SNF2beta, Brg1, SW1/SNF, b2b692Clo, b2b508.1Clo
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20586
Homologene: 135927
Inpp5d
Name: inositol polyphosphate-5-phosphatase D
Synonyms: SHIP, Src homology 2 domain-containing inositol-5-phosphatase, s-SHIP, SHIP-1, SHIP1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16331
HGNC: HGNC:6079
Homologene: 4046
Mmp10
Name: matrix metallopeptidase 10
Synonyms: stromelysin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17384
VEGA: 9
HGNC: HGNC:7156
Homologene: 20546
Slc17a6
Name: solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
Synonyms: 2900073D12Rik, VGLUT2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 140919
Homologene: 121617
Uri1
Name: URI1, prefoldin-like chaperone
Synonyms: NNX3, Rmp, C80913
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19777
Homologene: 2813
Xrcc6
Name: X-ray repair complementing defective repair in Chinese hamster cells 6
Synonyms: Ku p70, Ku70, G22p1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14375
HGNC: HGNC:4055
Homologene: 37483
Ezr
Name: ezrin
Synonyms: ezrin, p81, cytovillin, Vil2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22350
Homologene: 55740
Mark3
Name: MAP/microtubule affinity regulating kinase 3
Synonyms: ETK-1, 1600015G02Rik, A430080F22Rik, C-TAK1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17169
VEGA: 12
HGNC: HGNC:6897
Homologene: 55653
Ank3
Name: ankyrin 3, epithelial
Synonyms: Ank-3, Ankyrin-3, AnkG, 2900054D09Rik, Ankyrin-G
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Cd72
Name: CD72 antigen
Synonyms: Ly-19, Ly-m19, Ly-32, Lyb-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12517
HGNC: HGNC:1696
Homologene: 1350
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Celf6
Name: CUGBP, Elav-like family member 6
Synonyms: 6330569O16Rik, Brunol6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76183
Homologene: 129318
Sbf1
Name: SET binding factor 1
Synonyms: 2610510A08Rik, Mtmr5, B230113C15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77980
Homologene: 84710
Btnl9
Name: butyrophilin-like 9
Synonyms: D330012D11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237754
Homologene: 68540
Recql5
Name: RecQ protein-like 5
Synonyms: Recql5b, Recq5b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 170472
HGNC: HGNC:9950
Homologene: 31232
Tatdn1
Name: TatD DNase domain containing 1
Synonyms: CDA11, 2310079P03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69694
VEGA: 15
Homologene: 57158
Rfx7
Name: regulatory factor X, 7
Synonyms: 2510005N23Rik, 9930116O05Rik, D130086K05Rik, Rfxdc2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319758
Homologene: 11275
Zfp574
Name: zinc finger protein 574
Synonyms: A630056B21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232976
Homologene: 11238
Piezo1
Name: piezo-type mechanosensitive ion channel component 1
Synonyms: Piezo1, Fam38a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234839
Homologene: 124356
Pcdh12
Name: protocadherin 12
Synonyms: VE-cadherin-2, vascular endothelial cadherin-2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 53601
HGNC: HGNC:8657
Homologene: 9574
Pdgfd
Name: platelet-derived growth factor, D polypeptide
Synonyms: 1110003I09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71785
VEGA: 9
Homologene: 11875
A830010M20Rik
Name: RIKEN cDNA A830010M20 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231570
VEGA: 5
Homologene: 128318
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, bob, nmf112, nmf181, nmf252, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Vax1
Name: ventral anterior homeobox 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22326
Homologene: 7593
Prkg2
Name: protein kinase, cGMP-dependent, type II
Synonyms: cGK-II, Prkgr2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19092
HGNC: HGNC:9416
Homologene: 4556
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Naip5
Name: NLR family, apoptosis inhibitory protein 5
Synonyms: Naip-rs3, Birc1e, Lgn1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17951
HGNC: HGNC:7634
Homologene: 113589
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Slco1a8
Name: solute carrier organic anion transporter family, member 1a8
Synonyms: Gm6614
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 625716
Homologene: 87075
Zfp804b
Name: zinc finger protein 804B
Synonyms: LOC207618
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 207618
Homologene: 52304
Tcaf2
Name: TRPM8 channel-associated factor 2
Synonyms: Fam115c
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232748
Homologene: 17147
Mrps30
Name: mitochondrial ribosomal protein S30
Synonyms: 2610020A16Rik, Pdcd9
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 59054
HGNC: HGNC:8769
Homologene: 9607
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Fscb
Name: fibrous sheath CABYR binding protein
Synonyms: EG623046
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 623046
VEGA: 12
Homologene: 136275
Crxos
Name: cone-rod homeobox, opposite strand
Synonyms: Egam1, Crxos1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546024
Homologene: 136482
Fetub
Name: fetuin beta
Synonyms: 2310011O17Rik, D17980
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 59083
VEGA: 16
HGNC: HGNC:3658
Homologene: 8660
Zfp329
Name: zinc finger protein 329
Synonyms: 2810439M05Rik, 4632409L22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67230
Homologene: 23459
Sel1l3
Name: sel-1 suppressor of lin-12-like 3 (C. elegans)
Synonyms: 2310045A20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231238
Homologene: 9054
Or4c116
Name: olfactory receptor family 4 subfamily C member 116
Synonyms: GA_x6K02T2Q125-50591144-50590209, MOR233-3, Olfr1221
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258904
Homologene: 73987
Tll2
Name: tolloid-like 2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 24087
VEGA: 19
Homologene: 56545
Kif26b
Name: kinesin family member 26B
Synonyms: N-11 kinesin, D230039L06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269152
Homologene: 18623
Ric8a
Name: RIC8 guanine nucleotide exchange factor A
Synonyms: RIC-8, synembryn, Ric8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101489
Homologene: 23331
Maf
Name: MAF bZIP transcription factor
Synonyms: c-maf, A230108G15Rik, 2810401A20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17132
HGNC: HGNC:6776
Homologene: 74552
Xrra1
Name: X-ray radiation resistance associated 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 446101
Homologene: 19547
Tob2
Name: transducer of ERBB2, 2
Synonyms: 2900090N22Rik, 4930545K18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 57259
VEGA: 15
Homologene: 9447
Vmn2r95
Name: vomeronasal 2, receptor 95
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328759
Homologene: 115024
Gpr182
Name: G protein-coupled receptor 182
Synonyms: Gpcr17, Gpcr22, NOW, G10-D, AM-R, Admr
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11536
Homologene: 5255
Thrb
Name: thyroid hormone receptor beta
Synonyms: T3Rbeta, T3R[b], Nr1a2, TR beta, c-erbAbeta, Thrb2, Thrb1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21834
Homologene: 36025
Gm340
Name: predicted gene 340
Synonyms: LOC381224
Type: Gene
Species: Mouse
Chromosome: 19
Gdpd1
Name: glycerophosphodiester phosphodiesterase domain containing 1
Synonyms: 2610020H15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66569
Homologene: 7069
Upk1b
Name: uroplakin 1B
Synonyms: Upk1, Tspan20
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22268
VEGA: 16
Homologene: 5065
Evi2a
Name: ecotropic viral integration site 2a
Synonyms: Evi-2, Evi2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14017
HGNC: HGNC:3499
Homologene: 49234
Vmn2r38
Name: vomeronasal 2, receptor 38
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434110
Homologene: 113703
Tcl1b2
Name: T cell leukemia/lymphoma 1B, 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 27381
Homologene: 83274
Gm38119
Name: predicted gene, 38119
Type: Gene
Species: Mouse
Chromosome: 3
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 87,683,762 bp
  • G to A, chromosome 1 at 178,529,525 bp
  • A to T, chromosome 1 at 188,743,619 bp
  • T to C, chromosome 2 at 89,112,282 bp
  • G to T, chromosome 3 at 92,738,230 bp
  • T to C, chromosome 4 at 43,450,185 bp
  • A to G, chromosome 4 at 129,225,950 bp
  • A to G, chromosome 4 at 145,086,735 bp
  • T to C, chromosome 5 at 6,772,635 bp
  • G to T, chromosome 5 at 53,174,806 bp
  • C to T, chromosome 5 at 98,969,980 bp
  • A to G, chromosome 5 at 107,470,987 bp
  • A to G, chromosome 6 at 42,629,538 bp
  • A to T, chromosome 6 at 141,987,844 bp
  • C to A, chromosome 7 at 9,075,483 bp
  • T to C, chromosome 7 at 12,810,563 bp
  • T to C, chromosome 7 at 15,898,574 bp
  • T to A, chromosome 7 at 25,080,391 bp
  • T to C, chromosome 7 at 37,961,578 bp
  • G to A, chromosome 7 at 51,649,160 bp
  • A to G, chromosome 7 at 99,906,554 bp
  • A to G, chromosome 7 at 140,858,893 bp
  • ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG to ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG, chromosome 7 at 142,296,596 bp
  • T to A, chromosome 8 at 115,705,873 bp
  • T to C, chromosome 8 at 122,501,794 bp
  • A to G, chromosome 9 at 6,377,000 bp
  • A to G, chromosome 9 at 7,502,686 bp
  • T to C, chromosome 9 at 21,638,728 bp
  • C to A, chromosome 9 at 59,578,467 bp
  • T to C, chromosome 9 at 72,617,513 bp
  • T to A, chromosome 10 at 60,488,593 bp
  • A to T, chromosome 10 at 69,882,426 bp
  • T to C, chromosome 10 at 127,750,660 bp
  • T to A, chromosome 11 at 49,175,787 bp
  • G to T, chromosome 11 at 55,281,103 bp
  • T to A, chromosome 11 at 79,527,705 bp
  • A to G, chromosome 11 at 87,059,492 bp
  • T to C, chromosome 11 at 115,895,802 bp
  • T to C, chromosome 12 at 64,471,621 bp
  • T to C, chromosome 12 at 105,147,121 bp
  • C to A, chromosome 12 at 111,646,690 bp
  • T to A, chromosome 13 at 100,219,830 bp
  • T to C, chromosome 13 at 118,387,002 bp
  • A to G, chromosome 14 at 18,002,558 bp
  • A to T, chromosome 15 at 47,607,117 bp
  • T to C, chromosome 15 at 58,890,694 bp
  • AGATGATGA to AGATGA, chromosome 15 at 81,851,727 bp
  • C to T, chromosome 15 at 82,027,382 bp
  • C to T, chromosome 15 at 89,301,859 bp
  • A to T, chromosome 16 at 22,939,432 bp
  • A to G, chromosome 16 at 38,787,101 bp
  • T to C, chromosome 17 at 6,753,993 bp
  • A to G, chromosome 17 at 18,451,528 bp
  • G to A, chromosome 18 at 38,283,056 bp
  • T to C, chromosome 19 at 41,121,375 bp
  • C to T, chromosome 19 at 41,585,259 bp
  • T to C, chromosome 19 at 59,169,815 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8788 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068607-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.