Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8719Btlr/Mmmh
Stock Number:
068614-MU
Citation ID:
RRID:MMRRC_068614-MU
Other Names:
R8719 (G1)
Major Collection:

Strain Information

Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Cntnap2
Name: contactin associated protein-like 2
Synonyms: 5430425M22Rik, Caspr2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66797
Homologene: 69159
Lamb3
Name: laminin, beta 3
Synonyms: nicein, 125kDa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16780
HGNC: HGNC:6490
Homologene: 191
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Meis1
Name: Meis homeobox 1
Synonyms: C530044H18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17268
HGNC: HGNC:7000
Homologene: 86803
Ahdc1
Name: AT hook, DNA binding motif, containing 1
Synonyms: D030015G18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230793
Homologene: 17144
Hdac5
Name: histone deacetylase 5
Synonyms: mHDA1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15184
Homologene: 3995
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 10,090,291 bp
  • C to A, chromosome 1 at 54,263,509 bp
  • T to C, chromosome 1 at 58,119,537 bp
  • A to G, chromosome 1 at 84,745,069 bp
  • T to C, chromosome 1 at 193,323,791 bp
  • A to G, chromosome 2 at 33,243,902 bp
  • T to C, chromosome 2 at 76,712,697 bp
  • A to G, chromosome 2 at 76,776,802 bp
  • T to C, chromosome 2 at 103,980,919 bp
  • T to C, chromosome 2 at 128,641,449 bp
  • T to A, chromosome 2 at 155,829,208 bp
  • T to A, chromosome 4 at 133,064,222 bp
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp
  • A to T, chromosome 5 at 14,713,764 bp
  • T to G, chromosome 5 at 25,941,164 bp
  • T to A, chromosome 5 at 30,931,030 bp
  • T to C, chromosome 5 at 110,867,042 bp
  • T to G, chromosome 5 at 134,901,796 bp
  • T to A, chromosome 5 at 135,911,144 bp
  • T to G, chromosome 5 at 146,493,816 bp
  • A to T, chromosome 6 at 46,001,227 bp
  • T to G, chromosome 7 at 38,522,190 bp
  • A to T, chromosome 7 at 45,232,892 bp
  • A to G, chromosome 7 at 85,871,887 bp
  • T to A, chromosome 7 at 127,592,662 bp
  • A to T, chromosome 7 at 132,850,611 bp
  • T to A, chromosome 8 at 25,983,475 bp
  • T to C, chromosome 8 at 46,513,663 bp
  • G to T, chromosome 8 at 72,723,511 bp
  • A to T, chromosome 8 at 109,614,623 bp
  • A to T, chromosome 8 at 109,733,229 bp
  • A to T, chromosome 8 at 123,288,128 bp
  • C to A, chromosome 9 at 7,041,641 bp
  • T to C, chromosome 9 at 22,279,275 bp
  • C to A, chromosome 9 at 105,682,195 bp
  • A to G, chromosome 10 at 68,436,841 bp
  • A to G, chromosome 10 at 103,404,315 bp
  • A to G, chromosome 10 at 127,993,623 bp
  • A to G, chromosome 10 at 130,348,239 bp
  • A to G, chromosome 11 at 18,885,587 bp
  • T to C, chromosome 11 at 70,401,963 bp
  • C to A, chromosome 11 at 79,390,293 bp
  • T to C, chromosome 11 at 102,207,137 bp
  • A to G, chromosome 12 at 44,539,542 bp
  • T to A, chromosome 12 at 79,182,800 bp
  • A to G, chromosome 12 at 100,301,553 bp
  • T to C, chromosome 12 at 100,838,562 bp
  • G to A, chromosome 12 at 111,806,075 bp
  • C to A, chromosome 12 at 112,979,684 bp
  • A to T, chromosome 14 at 44,103,277 bp
  • A to T, chromosome 14 at 59,496,865 bp
  • T to C, chromosome 14 at 73,029,671 bp
  • C to G, chromosome 15 at 94,344,022 bp
  • T to C, chromosome 15 at 95,094,367 bp
  • T to A, chromosome 17 at 30,741,315 bp
  • T to C, chromosome 17 at 36,041,943 bp
  • T to C, chromosome 17 at 37,953,004 bp
  • A to T, chromosome 18 at 52,894,838 bp
  • T to C, chromosome 19 at 6,995,270 bp
  • A to G, chromosome 19 at 12,283,428 bp
  • A to G, chromosome 19 at 13,234,472 bp
  • A to T, chromosome 19 at 29,331,881 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8719 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068614-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.