Strain Name:
C57BL/6J-MtgxR8719Btlr/Mmmh
Stock Number:
068614-MU
Citation ID:
RRID:MMRRC_068614-MU
Other Names:
R8719 (G1)
Major Collection:

Strain Information

Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Cntnap2
Name: contactin associated protein-like 2
Synonyms: 5430425M22Rik, Caspr2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66797
Homologene: 69159
Lamb3
Name: laminin, beta 3
Synonyms: nicein, 125kDa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16780
HGNC: HGNC:6490
Homologene: 191
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Meis1
Name: Meis homeobox 1
Synonyms: C530044H18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17268
HGNC: HGNC:7000
Homologene: 86803
Ahdc1
Name: AT hook, DNA binding motif, containing 1
Synonyms: D030015G18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230793
Homologene: 17144
Hdac5
Name: histone deacetylase 5
Synonyms: mHDA1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15184
Homologene: 3995
Pelp1
Name: proline, glutamic acid and leucine rich protein 1
Synonyms: 4930563C04Rik, MNAR
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75273
Homologene: 8664
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Nf-1, Dsk9, Mhdadsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Sin3b
Name: transcriptional regulator, SIN3B (yeast)
Synonyms: 2810430C10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20467
Homologene: 81810
Rnf40
Name: ring finger protein 40
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233900
Homologene: 8856
Anapc1
Name: anaphase promoting complex subunit 1
Synonyms: tsg24, Apc1, 2610021O03Rik, Mcpr
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17222
Homologene: 7414
Trip12
Name: thyroid hormone receptor interactor 12
Synonyms: Gtl6, 1110036I07Rik, 6720416K24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14897
Homologene: 44226
Ywhag
Name: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide
Synonyms: D7Bwg1348e, 14-3-3 gamma
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22628
Homologene: 22725
Chek2
Name: checkpoint kinase 2
Synonyms: CHK2, Rad53
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50883
Homologene: 38289
Klc1
Name: kinesin light chain 1
Synonyms: Kns2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16593
HGNC: HGNC:6387
Homologene: 4056
Cspp1
Name: centrosome and spindle pole associated protein 1
Synonyms: 4930413O22Rik, 2310020J12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 211660
Homologene: 23487
Angptl2
Name: angiopoietin-like 2
Synonyms: Arp2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26360
HGNC: HGNC:490
Homologene: 22695
Rdh11
Name: retinol dehydrogenase 11
Synonyms: M42C60, 2610319N22Rik, Psdr1, Mdt1, Arsdr1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17252
Homologene: 100724
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Cab39l
Name: calcium binding protein 39-like
Synonyms: 1500031K13Rik, 2810425O13Rik, MO2L, 4930520C08Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 69008
VEGA: 14
Homologene: 69422
Ttc7b
Name: tetratricopeptide repeat domain 7B
Synonyms: Ttc7l1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104718
VEGA: 12
Homologene: 14675
Lmo2
Name: LIM domain only 2
Synonyms: Rbtn-2, Rbtn2, Rhom-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16909
HGNC: HGNC:6642
Homologene: 4072
H2-T22
Name: histocompatibility 2, T region locus 22
Synonyms: H-2T22, H-2T17, H2-T17
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15039
Homologene: 79525
Tespa1
Name: thymocyte expressed, positive selection associated 1
Synonyms: A430001F24Rik, 5830405N20Rik, Itprid3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67596
VEGA: 10
Homologene: 106645
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Pik3r4
Name: phosphoinositide-3-kinase regulatory subunit 4
Synonyms: Vps15, p150
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75669
HGNC: HGNC:8982
Homologene: 24678
Acsl1
Name: acyl-CoA synthetase long-chain family member 1
Synonyms: Acas1, Facl2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14081
HGNC: HGNC:3569
Homologene: 37561
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74183
Homologene: 135954
Cabcoco1
Name: ciliary associated calcium binding coiled-coil 1
Synonyms: 1700040L02Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73287
Homologene: 12495
Ccdc150
Name: coiled-coil domain containing 150
Synonyms: 4930511H11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78016
Homologene: 15814
Aox3
Name: aldehyde oxidase 3
Synonyms: AOH1, 1200011D03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71724
Homologene: 90899
Vmn2r73
Name: vomeronasal 2, receptor 73
Synonyms: EG620928
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620928
Homologene: 115466
Eef1akmt2
Name: EEF1A lysine methyltransferase 2
Synonyms: 2010208K18Rik, Mettl10
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72096
Homologene: 6175
Dglucy
Name: D-glutamate cyclase
Synonyms: 9030617O03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217830
Homologene: 11798
Brf1
Name: BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit
Synonyms: TAF3C, TFIIIB90, GTF3B, TAFIII90, 2510002F24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72308
VEGA: 12
Homologene: 1161
Fanca
Name: Fanconi anemia, complementation group A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14087
HGNC: HGNC:3582
Homologene: 108
Tmem270
Name: transmembrane protein 270
Synonyms: 1700111I05Rik, Wbscr28
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76629
Homologene: 18790
Slc6a15
Name: solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms: v7-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103098
VEGA: 10
Homologene: 18163
Rln1
Name: relaxin 1
Synonyms: rlx
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19773
Homologene: 55524
Sncaip
Name: synuclein, alpha interacting protein (synphilin)
Synonyms: 4933427B05Rik, SYPH1, synphilin-1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67847
Homologene: 3987
Fam83c
Name: family with sequence similarity 83, member C
Synonyms: 5530400B04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71405
Homologene: 18669
Hsd17b6
Name: hydroxysteroid (17-beta) dehydrogenase 6
Synonyms: Rdh8, 17betaHSD9, Hsd17b9
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27400
VEGA: 10
Homologene: 20811
Tead2
Name: TEA domain family member 2
Synonyms: TEF-4, TEAD-2, Etdf
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21677
Homologene: 19662
Gm6370
Name: predicted gene 6370
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 622924
Homologene: 86127
Ear2
Name: eosinophil-associated, ribonuclease A family, member 2
Synonyms: eosinophil-derived neurotoxin, liver, Rnase2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13587
Homologene: 40596
Atxn1l
Name: ataxin 1-like
Synonyms: C330011L24Rik, ENSMUSG00000069895, Boat, D8Ertd587e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52335
Homologene: 19471
Or5an1
Name: olfactory receptor family 5 subfamily AN member 1
Synonyms: GA_x6K02T2RE5P-2618516-2619454, GA_x6K02T2RE5P-2610001-2610414, MOR214-4, MOR214-4, Olfr1433, Olfr1434
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258680
Homologene: 45029
Tmem117
Name: transmembrane protein 117
Synonyms: B930062P21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320709
VEGA: 15
Homologene: 12992
Or5b109
Name: olfactory receptor family 5 subfamily B member 109
Synonyms: GA_x6K02T2RE5P-3560863-3561795, MOR202-29P, Olfr1463
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258120
HGNC: HGNC:8324
Homologene: 133886
Nudt22
Name: nudix hydrolase 22
Synonyms: 0610006K04Rik, nudix (nucleoside diphosphate linked moiety X)-type motif 22
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68323
Homologene: 12261
Or14j8
Name: olfactory receptor family 14 subfamily J member 8
Synonyms: GA_x6K02T2PSCP-2403971-2403000, MOR218-6P, MOR218-5P, MOR218-12, MOR218-6P, Olfr1552-ps1, Olfr761
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258094
Homologene: 134080
Zfp810
Name: zinc finger protein 810
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235050
VEGA: 9
Homologene: 138299
Cysltr2
Name: cysteinyl leukotriene receptor 2
Synonyms: CYSLT2R, Cyslt2, CysLT2, 2300001H05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70086
VEGA: 14
Homologene: 10688
Pomk
Name: protein-O-mannose kinase
Synonyms: Sgk196, 4930444A02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74653
Homologene: 12580
Gm5591
Name: predicted gene 5591
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434171
Homologene: 80005
Khk
Name: ketohexokinase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16548
HGNC: HGNC:6315
Homologene: 38187
Gm21663
Name: predicted gene, 21663
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100862349
Homologene: 69402
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 10,090,291 bp
  • C to A, chromosome 1 at 54,263,509 bp
  • T to C, chromosome 1 at 58,119,537 bp
  • A to G, chromosome 1 at 84,745,069 bp
  • T to C, chromosome 1 at 193,323,791 bp
  • A to G, chromosome 2 at 33,243,902 bp
  • T to C, chromosome 2 at 76,712,697 bp
  • A to G, chromosome 2 at 76,776,802 bp
  • T to C, chromosome 2 at 103,980,919 bp
  • T to C, chromosome 2 at 128,641,449 bp
  • T to A, chromosome 2 at 155,829,208 bp
  • T to A, chromosome 4 at 133,064,222 bp
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp
  • A to T, chromosome 5 at 14,713,764 bp
  • T to G, chromosome 5 at 25,941,164 bp
  • T to A, chromosome 5 at 30,931,030 bp
  • T to C, chromosome 5 at 110,867,042 bp
  • T to G, chromosome 5 at 134,901,796 bp
  • T to A, chromosome 5 at 135,911,144 bp
  • T to G, chromosome 5 at 146,493,816 bp
  • A to T, chromosome 6 at 46,001,227 bp
  • T to G, chromosome 7 at 38,522,190 bp
  • A to T, chromosome 7 at 45,232,892 bp
  • A to G, chromosome 7 at 85,871,887 bp
  • T to A, chromosome 7 at 127,592,662 bp
  • A to T, chromosome 7 at 132,850,611 bp
  • T to A, chromosome 8 at 25,983,475 bp
  • T to C, chromosome 8 at 46,513,663 bp
  • G to T, chromosome 8 at 72,723,511 bp
  • A to T, chromosome 8 at 109,614,623 bp
  • A to T, chromosome 8 at 109,733,229 bp
  • A to T, chromosome 8 at 123,288,128 bp
  • C to A, chromosome 9 at 7,041,641 bp
  • T to C, chromosome 9 at 22,279,275 bp
  • C to A, chromosome 9 at 105,682,195 bp
  • A to G, chromosome 10 at 68,436,841 bp
  • A to G, chromosome 10 at 103,404,315 bp
  • A to G, chromosome 10 at 127,993,623 bp
  • A to G, chromosome 10 at 130,348,239 bp
  • A to G, chromosome 11 at 18,885,587 bp
  • T to C, chromosome 11 at 70,401,963 bp
  • C to A, chromosome 11 at 79,390,293 bp
  • T to C, chromosome 11 at 102,207,137 bp
  • A to G, chromosome 12 at 44,539,542 bp
  • T to A, chromosome 12 at 79,182,800 bp
  • A to G, chromosome 12 at 100,301,553 bp
  • T to C, chromosome 12 at 100,838,562 bp
  • G to A, chromosome 12 at 111,806,075 bp
  • C to A, chromosome 12 at 112,979,684 bp
  • A to T, chromosome 14 at 44,103,277 bp
  • A to T, chromosome 14 at 59,496,865 bp
  • T to C, chromosome 14 at 73,029,671 bp
  • C to G, chromosome 15 at 94,344,022 bp
  • T to C, chromosome 15 at 95,094,367 bp
  • T to A, chromosome 17 at 30,741,315 bp
  • T to C, chromosome 17 at 36,041,943 bp
  • T to C, chromosome 17 at 37,953,004 bp
  • A to T, chromosome 18 at 52,894,838 bp
  • T to C, chromosome 19 at 6,995,270 bp
  • A to G, chromosome 19 at 12,283,428 bp
  • A to G, chromosome 19 at 13,234,472 bp
  • A to T, chromosome 19 at 29,331,881 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8719 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068614-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.