Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8736Btlr/Mmmh
Stock Number:
068617-MU
Citation ID:
RRID:MMRRC_068617-MU
Other Names:
R8736 (G1)
Major Collection:

Strain Information

Gtf2h3
Name: general transcription factor IIH, polypeptide 3
Synonyms: 5033417D07Rik, BTF2, D5Ertd679e, 34kDa
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 209357
HGNC: HGNC:4657
Homologene: 1160
Mapkapk5
Name: MAP kinase-activated protein kinase 5
Synonyms: PRAK, MK5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17165
HGNC: HGNC:6889
Homologene: 69077
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Usp1
Name: ubiquitin specific peptidase 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230484
Homologene: 2528
Cyb5a
Name: cytochrome b5 type A (microsomal)
Synonyms: 0610009N12Rik, Cyb5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 109672
HGNC: HGNC:2570
Homologene: 41475
Plxnb2
Name: plexin B2
Synonyms: Debt, 1110007H23Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 140570
HGNC: HGNC:9104
Homologene: 66630
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: l(7)-3Rn, Ten-m4, Doc4, l7Rn3, ELM2, Odz4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Pms1
Name: PMS1 homolog 1, mismatch repair system component
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227099
HGNC: HGNC:9121
Homologene: 449
Maml1
Name: mastermind like transcriptional coactivator 1
Synonyms: Mam-1, D930008C07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103806
Homologene: 8845
Cul2
Name: cullin 2
Synonyms: 1300003D18Rik, 4932411N15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71745
HGNC: HGNC:2552
Homologene: 2662
Morc2a
Name: microrchidia 2A
Synonyms: 8430403M08Rik, Zcwcc1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74522
Homologene: 8966
Rap1gds1
Name: RAP1, GTP-GDP dissociation stimulator 1
Synonyms: GDS1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229877
HGNC: HGNC:9859
Homologene: 41422
Zfp870
Name: zinc finger protein 870
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240066
VEGA: 17
Homologene: 48189
Ddr1
Name: discoidin domain receptor family, member 1
Synonyms: CD167a, Cak
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12305
HGNC: HGNC:2730
Homologene: 68212
Ccdc125
Name: coiled-coil domain containing 125
Synonyms: 5830436D01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76041
VEGA: 13
Homologene: 27932
Bltp2
Name: bridge-like lipid transfer protein family member 2
Synonyms: 2610507B11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72503
Homologene: 34730
Vmn2r6
Name: vomeronasal 2, receptor 6
Synonyms: EG620718, EG667069
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 667069
Homologene: 129754
Or7g20
Name: olfactory receptor family 7 subfamily G member 20
Synonyms: GA_x6K02T2PVTD-12771995-12772930, MOR150-3, Olfr835
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 257872
HGNC: HGNC:8466
Homologene: 133702
Ddhd1
Name: DDHD domain containing 1
Synonyms: 9630061G18Rik, 4921528E07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 114874
Homologene: 35221
Mapk4
Name: mitogen-activated protein kinase 4
Synonyms: Erk3-related, p63Mapk, A330097D03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225724
HGNC: HGNC:6878
Homologene: 2058
Ppp1r18
Name: protein phosphatase 1, regulatory subunit 18
Synonyms: 2310014H01Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76448
Homologene: 19512
Or9i14
Name: olfactory receptor family 9 subfamily I member 14
Synonyms: GA_x6K02T2RE5P-4147744-4146800, MOR211-2, Olfr1499
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258792
Homologene: 17393
Or9s18
Name: olfactory receptor family 9 subfamily S member 18
Synonyms: GA_x6K02T2PB7A-3051266-3052192, MOR209-1, Olfr466
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 258816
Homologene: 72032
Fcgbp
Name: Fc fragment of IgG binding protein
Synonyms: A430096B05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 215384
Homologene: 68369
Or4b12
Name: olfactory receptor family 4 subfamily B member 12
Synonyms: GA_x6K02T2Q125-51620802-51619885, MOR227-5, Olfr1271
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258789
HGNC: HGNC:8290
Or1e21
Name: olfactory receptor family 1 subfamily E member 21
Synonyms: GA_x6K02T2P1NL-3613021-3612086, MOR135-1, Olfr380
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259027
Homologene: 74109
Or5a1
Name: olfactory receptor family 5 subfamily A member 1
Synonyms: V5, MOR215-3, GA_x6K02T2RE5P-2479601-2478648, Olfr76
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258677
HGNC: HGNC:8319
Homologene: 17342
Krt6b
Name: keratin 6B
Synonyms: mK6[b], Krt2-6b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16688
VEGA: 15
Homologene: 136794
Rftn1
Name: raftlin lipid raft linker 1
Synonyms: 2310015N21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76438
Homologene: 18745
Elovl7
Name: ELOVL fatty acid elongase 7
Synonyms: 9130013K24Rik, ELOVL family member 7, elongation of long chain fatty acids (yeast)
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74559
VEGA: 13
Homologene: 23672
Ccnl1
Name: cyclin L1
Synonyms: ania-6a, 2610030E23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56706
Homologene: 10541
Tlx1
Name: T cell leukemia, homeobox 1
Synonyms: Hox11, Hox-11
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21908
HGNC: HGNC:5056
Homologene: 4031
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 53,267,894 bp
  • A to G, chromosome 2 at 90,265,578 bp
  • T to A, chromosome 3 at 64,559,800 bp
  • T to C, chromosome 3 at 65,958,026 bp
  • C to A, chromosome 3 at 86,547,300 bp
  • T to C, chromosome 3 at 138,941,751 bp
  • A to G, chromosome 4 at 98,932,868 bp
  • G to A, chromosome 5 at 121,527,178 bp
  • A to G, chromosome 5 at 124,590,909 bp
  • G to T, chromosome 7 at 28,106,196 bp
  • C to T, chromosome 7 at 96,905,941 bp
  • A to G, chromosome 7 at 116,376,229 bp
  • T to C, chromosome 7 at 141,642,172 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • G to A, chromosome 9 at 18,550,843 bp
  • G to T, chromosome 9 at 19,035,478 bp
  • C to A, chromosome 11 at 3,681,737 bp
  • T to C, chromosome 11 at 50,257,899 bp
  • T to A, chromosome 11 at 73,453,558 bp
  • T to A, chromosome 11 at 78,288,049 bp
  • T to G, chromosome 13 at 65,152,724 bp
  • T to C, chromosome 13 at 100,679,325 bp
  • A to T, chromosome 13 at 108,256,786 bp
  • T to A, chromosome 14 at 45,599,185 bp
  • A to T, chromosome 15 at 89,162,058 bp
  • A to G, chromosome 15 at 101,678,612 bp
  • A to T, chromosome 17 at 32,885,992 bp
  • A to G, chromosome 17 at 35,684,212 bp
  • A to G, chromosome 17 at 35,873,819 bp
  • G to T, chromosome 17 at 50,047,380 bp
  • T to A, chromosome 18 at 3,434,019 bp
  • T to C, chromosome 18 at 73,970,325 bp
  • C to A, chromosome 18 at 84,851,435 bp
  • A to G, chromosome 19 at 12,119,945 bp
  • T to C, chromosome 19 at 13,814,994 bp
  • A to G, chromosome 19 at 45,153,536 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8736 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068617-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.