Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8769Btlr/Mmmh
Stock Number:
068624-MU
Citation ID:
RRID:MMRRC_068624-MU
Other Names:
R8769 (G1)
Major Collection:

Strain Information

Thbs3
Name: thrombospondin 3
Synonyms: Thbs-3, TSP3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 21827
Homologene: 5159
Hsd17b12
Name: hydroxysteroid (17-beta) dehydrogenase 12
Synonyms: KIK-I, 2610510O05Rik, keratoadhesin, keratonectin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56348
Homologene: 95094
Prkca
Name: protein kinase C, alpha
Synonyms: Pkca
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18750
HGNC: HGNC:9393
Homologene: 55679
Bbx
Name: bobby sox HMG box containing
Synonyms: 5730403O13Rik, 5530401J07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70508
Homologene: 10634
Adgrl2
Name: adhesion G protein-coupled receptor L2
Synonyms: Lphh1, Lec1, Lphn2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99633
Homologene: 22712
Sec62
Name: SEC62 homolog, preprotein translocation
Synonyms: HTP1, Dtrp1, SEC62, 3100002M17Rik, Tloc1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69276
Homologene: 2449
Mdn1
Name: midasin AAA ATPase 1
Synonyms: LOC213784, 4833432B22Rik, D4Abb1e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100019
Homologene: 39689
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 53,913,348 bp
  • T to A, chromosome 1 at 60,235,211 bp
  • A to G, chromosome 1 at 87,481,161 bp
  • T to C, chromosome 2 at 30,828,131 bp
  • T to A, chromosome 2 at 68,616,245 bp
  • A to T, chromosome 2 at 87,645,616 bp
  • A to T, chromosome 2 at 94,115,052 bp
  • T to C, chromosome 2 at 151,667,918 bp
  • T to C, chromosome 3 at 30,810,028 bp
  • G to A, chromosome 3 at 89,224,630 bp
  • C to T, chromosome 3 at 108,075,297 bp
  • T to C, chromosome 3 at 148,817,281 bp
  • C to A, chromosome 4 at 32,751,390 bp
  • T to C, chromosome 4 at 125,656,373 bp
  • T to A, chromosome 4 at 155,418,648 bp
  • T to C, chromosome 5 at 24,598,794 bp
  • T to C, chromosome 5 at 30,073,362 bp
  • C to T, chromosome 5 at 34,820,289 bp
  • C to T, chromosome 5 at 92,083,497 bp
  • A to G, chromosome 5 at 121,281,873 bp
  • T to A, chromosome 6 at 18,376,004 bp
  • C to T, chromosome 6 at 34,857,614 bp
  • C to T, chromosome 6 at 38,336,481 bp
  • G to T, chromosome 6 at 126,880,245 bp
  • A to T, chromosome 7 at 4,641,290 bp
  • C to A, chromosome 7 at 24,638,507 bp
  • T to A, chromosome 7 at 43,980,242 bp
  • A to T, chromosome 7 at 81,585,185 bp
  • G to A, chromosome 7 at 141,818,872 bp
  • T to C, chromosome 8 at 91,252,584 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • A to T, chromosome 8 at 124,679,077 bp
  • T to A, chromosome 9 at 44,508,966 bp
  • C to T, chromosome 9 at 57,727,395 bp
  • C to A, chromosome 9 at 75,025,825 bp
  • T to A, chromosome 9 at 124,029,059 bp
  • A to T, chromosome 10 at 77,932,294 bp
  • A to T, chromosome 10 at 116,776,791 bp
  • G to A, chromosome 11 at 29,561,401 bp
  • G to A, chromosome 11 at 73,690,301 bp
  • G to T, chromosome 11 at 75,543,366 bp
  • A to G, chromosome 11 at 103,498,710 bp
  • A to T, chromosome 11 at 107,951,460 bp
  • T to A, chromosome 13 at 49,493,880 bp
  • A to G, chromosome 14 at 30,933,424 bp
  • A to G, chromosome 14 at 122,616,848 bp
  • A to T, chromosome 15 at 72,006,722 bp
  • A to G, chromosome 15 at 76,110,695 bp
  • A to G, chromosome 15 at 76,412,926 bp
  • A to G, chromosome 16 at 17,150,868 bp
  • T to C, chromosome 16 at 50,240,864 bp
  • A to G, chromosome 16 at 59,283,831 bp
  • C to T, chromosome 17 at 24,444,600 bp
  • T to C, chromosome 17 at 46,521,902 bp
  • T to C, chromosome 18 at 12,695,488 bp
  • C to T, chromosome 19 at 7,692,721 bp
  • T to A, chromosome 19 at 13,063,943 bp
  • A to G, chromosome 19 at 17,123,078 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8769 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068624-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.