Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8809Btlr/Mmmh
Stock Number:
068645-MU
Citation ID:
RRID:MMRRC_068645-MU
Other Names:
R8809 (G1)
Major Collection:

Strain Information

Lrig2
Name: leucine-rich repeats and immunoglobulin-like domains 2
Synonyms: 4632419I10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269473
Homologene: 8882
Chrnb2
Name: cholinergic receptor nicotinic beta 2 subunit
Synonyms: [b]2-nAchR, Acrb-2, Acrb2, C030030P04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11444
HGNC: HGNC:1962
Homologene: 595
Neurog1
Name: neurogenin 1
Synonyms: neurogenin, Math4C, ngn1, neurogenin 1, Neurod3, bHLHa6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18014
VEGA: 13
HGNC: HGNC:7764
Homologene: 4490
Ctnnal1
Name: catenin alpha like 1
Synonyms: ACRP, Catnal1, catenin (cadherin associated protein), alpha-like 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 54366
HGNC: HGNC:2512
Homologene: 2815
Zbtb7c
Name: zinc finger and BTB domain containing 7C
Synonyms: B230208J24Rik, Zbtb36, Kr-pok
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 207259
VEGA: 18
Homologene: 17070
Rock2
Name: Rho-associated coiled-coil containing protein kinase 2
Synonyms: Rock-II, B230113H15Rik, Rho-kinase, ROKalpha, Rock2m
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19878
VEGA: 12
Homologene: 21010
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Nf-1, Dsk9, Mhdadsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 74,903,223 bp
  • G to A, chromosome 1 at 155,098,970 bp
  • G to A, chromosome 1 at 192,221,414 bp
  • T to C, chromosome 2 at 73,273,675 bp
  • T to C, chromosome 2 at 88,831,912 bp
  • A to G, chromosome 2 at 131,178,402 bp
  • G to A, chromosome 3 at 34,054,281 bp
  • T to C, chromosome 3 at 89,757,150 bp
  • A to G, chromosome 3 at 93,332,136 bp
  • A to T, chromosome 3 at 99,982,422 bp
  • T to C, chromosome 3 at 104,461,677 bp
  • A to T, chromosome 3 at 130,560,817 bp
  • T to C, chromosome 4 at 41,498,812 bp
  • T to A, chromosome 4 at 56,835,374 bp
  • T to A, chromosome 5 at 33,666,685 bp
  • A to T, chromosome 5 at 109,287,008 bp
  • T to C, chromosome 5 at 121,684,461 bp
  • A to T, chromosome 6 at 57,926,367 bp
  • T to G, chromosome 6 at 70,726,518 bp
  • T to A, chromosome 6 at 73,032,563 bp
  • T to A, chromosome 6 at 131,220,235 bp
  • G to A, chromosome 6 at 139,768,710 bp
  • A to G, chromosome 7 at 16,112,626 bp
  • A to G, chromosome 7 at 22,790,350 bp
  • A to T, chromosome 7 at 27,132,570 bp
  • A to G, chromosome 7 at 79,375,956 bp
  • A to T, chromosome 7 at 103,220,239 bp
  • G to T, chromosome 7 at 110,853,792 bp
  • A to G, chromosome 7 at 130,674,691 bp
  • A to G, chromosome 8 at 11,245,916 bp
  • T to A, chromosome 8 at 41,197,331 bp
  • A to G, chromosome 8 at 55,872,624 bp
  • C to T, chromosome 8 at 70,852,653 bp
  • C to A, chromosome 8 at 93,060,320 bp
  • C to T, chromosome 8 at 93,060,321 bp
  • A to G, chromosome 8 at 116,999,921 bp
  • A to G, chromosome 9 at 18,815,623 bp
  • TCGCC to TC, chromosome 9 at 21,944,431 bp
  • T to C, chromosome 9 at 44,743,962 bp
  • A to T, chromosome 9 at 65,508,140 bp
  • A to T, chromosome 9 at 100,985,167 bp
  • T to C, chromosome 10 at 44,003,432 bp
  • A to T, chromosome 10 at 44,439,753 bp
  • C to T, chromosome 10 at 62,559,712 bp
  • C to T, chromosome 10 at 89,714,979 bp
  • A to G, chromosome 11 at 49,216,411 bp
  • T to A, chromosome 11 at 79,547,138 bp
  • A to G, chromosome 11 at 82,810,038 bp
  • A to T, chromosome 11 at 95,032,513 bp
  • T to C, chromosome 11 at 99,785,628 bp
  • A to G, chromosome 11 at 101,102,026 bp
  • A to T, chromosome 11 at 121,630,864 bp
  • T to A, chromosome 12 at 16,965,654 bp
  • T to C, chromosome 12 at 73,975,038 bp
  • CGGCGACCACGGCGGCGGCGGGGGCG to CGGCG, chromosome 12 at 108,793,580 bp
  • A to G, chromosome 12 at 116,229,614 bp
  • C to A, chromosome 13 at 23,855,592 bp
  • A to T, chromosome 13 at 40,717,353 bp
  • GGTG to GGTGTG, chromosome 13 at 56,251,285 bp
  • A to G, chromosome 14 at 50,281,779 bp
  • A to G, chromosome 14 at 73,265,560 bp
  • A to G, chromosome 15 at 9,367,259 bp
  • A to T, chromosome 16 at 20,734,520 bp
  • T to A, chromosome 16 at 58,915,885 bp
  • C to A, chromosome 17 at 34,908,513 bp
  • A to G, chromosome 18 at 14,627,287 bp
  • T to C, chromosome 18 at 76,137,119 bp
  • A to G, chromosome 18 at 84,960,075 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8809 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068645-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.