Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8818Btlr/Mmmh
Stock Number:
068651-MU
Citation ID:
RRID:MMRRC_068651-MU
Other Names:
R8818 (G1)
Major Collection:

Strain Information

Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Gldc
Name: glycine decarboxylase
Synonyms: D19Wsu57e, D030049L12Rik, b2b2679Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104174
VEGA: 19
HGNC: HGNC:4313
Homologene: 141
Nucb2
Name: nucleobindin 2
Synonyms: NEFA, Calnuc, nesfatin-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53322
HGNC: HGNC:8044
Homologene: 3676
Becn1
Name: beclin 1, autophagy related
Synonyms: Atg6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56208
HGNC: HGNC:1034
Homologene: 2794
Adam23
Name: a disintegrin and metallopeptidase domain 23
Synonyms: MDC3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23792
HGNC: HGNC:202
Homologene: 2826
Fzd8
Name: frizzled class receptor 8
Synonyms: Fz8, mFZ8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14370
VEGA: 18
HGNC: HGNC:4046
Homologene: 40606
Grhl2
Name: grainyhead like transcription factor 2
Synonyms: BOM, 0610015A08Rik, Tcfcp2l3, grainyheadlike, clft3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 252973
HGNC: HGNC:2799
Homologene: 32616
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 63,545,468 bp
  • C to A, chromosome 2 at 86,455,734 bp
  • C to T, chromosome 2 at 112,831,096 bp
  • T to G, chromosome 3 at 36,996,548 bp
  • T to A, chromosome 3 at 82,383,963 bp
  • T to A, chromosome 3 at 100,013,227 bp
  • T to C, chromosome 4 at 11,771,323 bp
  • A to G, chromosome 4 at 45,900,484 bp
  • A to T, chromosome 4 at 119,422,133 bp
  • C to A, chromosome 4 at 133,211,227 bp
  • A to G, chromosome 5 at 65,148,646 bp
  • A to T, chromosome 5 at 99,941,235 bp
  • A to T, chromosome 5 at 124,324,964 bp
  • T to A, chromosome 6 at 42,305,543 bp
  • G to T, chromosome 7 at 13,260,529 bp
  • C to T, chromosome 7 at 18,560,412 bp
  • T to A, chromosome 7 at 19,619,837 bp
  • T to G, chromosome 7 at 27,364,167 bp
  • T to A, chromosome 7 at 116,521,901 bp
  • G to T, chromosome 7 at 120,216,301 bp
  • C to A, chromosome 7 at 127,479,522 bp
  • T to G, chromosome 8 at 26,139,015 bp
  • A to G, chromosome 9 at 39,184,766 bp
  • A to T, chromosome 9 at 40,304,484 bp
  • T to C, chromosome 9 at 44,681,526 bp
  • A to C, chromosome 9 at 109,287,003 bp
  • A to T, chromosome 9 at 123,392,827 bp
  • TGTCACAGGT to TGT, chromosome 10 at 80,866,069 bp
  • A to G, chromosome 10 at 82,867,607 bp
  • T to G, chromosome 11 at 55,011,752 bp
  • A to G, chromosome 11 at 60,743,051 bp
  • A to G, chromosome 11 at 61,370,229 bp
  • G to A, chromosome 11 at 68,951,112 bp
  • A to G, chromosome 11 at 72,981,939 bp
  • A to T, chromosome 11 at 94,548,274 bp
  • A to T, chromosome 11 at 101,295,404 bp
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp
  • T to G, chromosome 12 at 103,628,804 bp
  • T to A, chromosome 12 at 117,911,029 bp
  • T to A, chromosome 13 at 24,717,668 bp
  • C to T, chromosome 13 at 59,600,947 bp
  • T to A, chromosome 14 at 30,518,942 bp
  • C to A, chromosome 14 at 55,594,939 bp
  • T to A, chromosome 15 at 37,270,668 bp
  • C to A, chromosome 15 at 79,485,719 bp
  • A to G, chromosome 16 at 19,769,597 bp
  • A to G, chromosome 17 at 32,524,094 bp
  • A to T, chromosome 17 at 46,672,410 bp
  • A to G, chromosome 18 at 9,214,474 bp
  • A to G, chromosome 18 at 20,340,542 bp
  • A to T, chromosome 18 at 25,158,308 bp
  • C to T, chromosome 18 at 37,335,784 bp
  • A to T, chromosome 19 at 3,467,216 bp
  • A to G, chromosome 19 at 10,941,016 bp
  • A to T, chromosome 19 at 22,978,588 bp
  • C to G, chromosome 19 at 30,100,812 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8818 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068651-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.