Strain Name:
C57BL/6J-MtgxR8818Btlr/Mmmh
Stock Number:
068651-MU
Citation ID:
RRID:MMRRC_068651-MU
Other Names:
R8818 (G1)
Major Collection:

Strain Information

Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: neuroaxonal dystrophy, ROSA62, SpbIV, nmf261, 1700022P15Rik, Spnb4, dyn, 5830426A08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Gldc
Name: glycine decarboxylase
Synonyms: D19Wsu57e, b2b2679Clo, D030049L12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104174
VEGA: 19
HGNC: HGNC:4313
Homologene: 141
Nucb2
Name: nucleobindin 2
Synonyms: nesfatin-1, Calnuc, NEFA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53322
HGNC: HGNC:8044
Homologene: 3676
Becn1
Name: beclin 1, autophagy related
Synonyms: Atg6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56208
HGNC: HGNC:1034
Homologene: 2794
Adam23
Name: a disintegrin and metallopeptidase domain 23
Synonyms: MDC3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23792
HGNC: HGNC:202
Homologene: 2826
Fzd8
Name: frizzled class receptor 8
Synonyms: mFZ8, Fz8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14370
VEGA: 18
HGNC: HGNC:4046
Homologene: 40606
Grhl2
Name: grainyhead like transcription factor 2
Synonyms: BOM, Tcfcp2l3, 0610015A08Rik, clft3, grainyheadlike
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 252973
HGNC: HGNC:2799
Homologene: 32616
Ppp6r3
Name: protein phosphatase 6, regulatory subunit 3
Synonyms: 4930528G08Rik, D19Bwg1430e, Pp6r3, 9130026N02Rik, Saps3, Pptcs3, D19Ertd703e
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52036
VEGA: 19
HGNC: HGNC:1173
Homologene: 115911
Bltp1
Name: bridge-like lipid transfer protein family member 1
Synonyms: 4932438A13Rik, Tweek, FSA
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229227
Homologene: 52105
Lars2
Name: leucyl-tRNA synthetase, mitochondrial
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102436
VEGA: 9
Homologene: 6526
Unc13d
Name: unc-13 homolog D
Synonyms: Jinx, 2610108D09Rik, Munc13-4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70450
Homologene: 26714
Dcp1a
Name: decapping mRNA 1A
Synonyms: 4930568L04Rik, SMIF, Mitc1, 1110066A22Rik, D14Ertd817e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 75901
VEGA: 14
Homologene: 10178
Rrp36
Name: ribosomal RNA processing 36
Synonyms: BC011248
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224823
VEGA: 17
Homologene: 40346
Gpr3
Name: G-protein coupled receptor 3
Synonyms: Gpcr3, Gpcr21
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14748
HGNC: HGNC:4484
Homologene: 31303
Ripor2
Name: RHO family interacting cell polarization regulator 2
Synonyms: E430013J17Rik, Fam65b, 1700108N18Rik, 6330500D04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 193385
Homologene: 9284
Anxa6
Name: annexin A6
Synonyms: Annexin VI, Camb, Anx6, Cabm, AnxVI
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11749
HGNC: HGNC:544
Homologene: 55558
Top3a
Name: topoisomerase (DNA) III alpha
Synonyms: Top IIIa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21975
Homologene: 3394
Naa35
Name: N(alpha)-acetyltransferase 35, NatC auxiliary subunit
Synonyms: A330027C19Rik, Mak10, A330021G12Rik, C030004C14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 78689
Homologene: 5781
Mphosph9
Name: M-phase phosphoprotein 9
Synonyms: B930097C17Rik, MPP-9, MPP9, 4930548D04Rik, 9630025B04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269702
HGNC: HGNC:7215
Homologene: 11256
Serpina10
Name: serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
Synonyms: PZI
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217847
Homologene: 9414
B3gnt5
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 108105
Homologene: 24989
Atp2a3
Name: ATPase, Ca++ transporting, ubiquitous
Synonyms: Serca3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53313
HGNC: HGNC:813
Homologene: 69131
Clcn1
Name: chloride channel, voltage-sensitive 1
Synonyms: NMF355, nmf355, SMCC1, Clc-1, Clc1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12723
HGNC: HGNC:2019
Homologene: 63
Trpm3
Name: transient receptor potential cation channel, subfamily M, member 3
Synonyms: B930001P07Rik, 6330504P12Rik, LTRPC3, melastatin 2, MLSN2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226025
VEGA: 19
Homologene: 62287
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: b2b1289Clo, b2b1203Clo, Dnahc11, b2b1279Clo, avc4, b2b1727Clo, b2b598Clo, lrd
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Ptgdr2
Name: prostaglandin D2 receptor 2
Synonyms: Crth2, PGD2 receptor, Gpr44
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14764
HGNC: HGNC:4502
Homologene: 3508
Tpgs2
Name: tubulin polyglutamylase complex subunit 2
Synonyms: 5730494M16Rik, 5730437P09Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66648
Homologene: 9161
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Gramd1b
Name: GRAM domain containing 1B
Synonyms: A930008A22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235283
Homologene: 18223
Treh
Name: trehalase (brush-border membrane glycoprotein)
Synonyms: 2210412M19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 58866
Homologene: 5198
Arhgef15
Name: Rho guanine nucleotide exchange factor 15
Synonyms: D530030K12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 442801
Homologene: 18345
Ccdc180
Name: coiled-coil domain containing 180
Synonyms: LOC381522, E230008N13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381522
Homologene: 117988
Cdh17
Name: cadherin 17
Synonyms: LI-cadherin, BILL-cadherin, HPT-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12557
HGNC: HGNC:1756
Homologene: 56859
Klhl5
Name: kelch-like 5
Synonyms: 1300013C10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71778
HGNC: HGNC:6356
Homologene: 56736
Fbxw14
Name: F-box and WD-40 domain protein 14
Synonyms: E330009N23Rik, Fbx12, Fbxo12
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50757
Homologene: 110776
Fbrs
Name: fibrosin
Synonyms: Fbs1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14123
Homologene: 79554
Spag17
Name: sperm associated antigen 17
Synonyms: PF6, 4931427F14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74362
Homologene: 52601
Abca14
Name: ATP-binding cassette, sub-family A member 14
Synonyms: 4930539G24Rik, 1700110B15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67928
Homologene: 86128
Dsg1a
Name: desmoglein 1 alpha
Synonyms: Dsg1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13510
HGNC: HGNC:3048
Homologene: 1463
Map9
Name: microtubule-associated protein 9
Synonyms: 5033421J10Rik, 5330427D05Rik, ASAP, Mtap9
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213582
Homologene: 41591
Rsad1
Name: radical S-adenosyl methionine domain containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237926
Homologene: 41252
Rnf31
Name: ring finger protein 31
Synonyms: Paul, HOIP
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268749
Homologene: 33228
Or8g26
Name: olfactory receptor family 8 subfamily G member 26
Synonyms: Olfr943, MOR171-44, GA_x6K02T2PVTD-32881408-32882343
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258323
VEGA: 9
HGNC: HGNC:8484
Homologene: 110526
Rnf170
Name: ring finger protein 170
Synonyms: 6720407G21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 77733
Homologene: 12807
Slc47a1
Name: solute carrier family 47, member 1
Synonyms: MATE1, 1300013J15Rik, mMATE1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67473
Homologene: 34364
Or8k28
Name: olfactory receptor family 8 subfamily K member 28
Synonyms: Olfr1066, MOR256-52P, MOR188-8, GA_x6K02T2Q125-47925557-47924616
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257880
Homologene: 79468
Psg27
Name: pregnancy-specific beta-1-glycoprotein 27
Synonyms: cea15, EG545925
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545925
Homologene: 110989
Cyp4f17
Name: cytochrome P450, family 4, subfamily f, polypeptide 17
Synonyms: EG208285
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 208285
VEGA: 17
Homologene: 129713
Zswim9
Name: zinc finger SWIM-type containing 9
Synonyms: 6330408A02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 321008
Homologene: 52386
Pcdhb6
Name: protocadherin beta 6
Synonyms: PcdhbF, Pcdhb5B
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93877
HGNC: HGNC:8690
Homologene: 62177
Ppcs
Name: phosphopantothenoylcysteine synthetase
Synonyms: 6330579B17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 106564
Homologene: 6173
Relb
Name: avian reticuloendotheliosis viral (v-rel) oncogene related B
Synonyms: shep
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19698
HGNC: HGNC:9956
Homologene: 4747
Kcnj4
Name: potassium inwardly-rectifying channel, subfamily J, member 4
Synonyms: Kcnf2, MB-IRK3, IRK3, Kir 2.3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16520
VEGA: 15
HGNC: HGNC:6265
Homologene: 3653
Sppl2b
Name: signal peptide peptidase like 2B
Synonyms: 3110056O03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73218
VEGA: 10
Homologene: 10605
Vamp9
Name: vesicle-associated membrane protein 9
Synonyms: Gm35911
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 102639650
VEGA: 5
Homologene: 140982
Eid3
Name: EP300 interacting inhibitor of differentiation 3
Synonyms: 1700027M21Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66341
Homologene: 81651
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 63,545,468 bp
  • C to A, chromosome 2 at 86,455,734 bp
  • C to T, chromosome 2 at 112,831,096 bp
  • T to G, chromosome 3 at 36,996,548 bp
  • T to A, chromosome 3 at 82,383,963 bp
  • T to A, chromosome 3 at 100,013,227 bp
  • T to C, chromosome 4 at 11,771,323 bp
  • A to G, chromosome 4 at 45,900,484 bp
  • A to T, chromosome 4 at 119,422,133 bp
  • C to A, chromosome 4 at 133,211,227 bp
  • A to G, chromosome 5 at 65,148,646 bp
  • A to T, chromosome 5 at 99,941,235 bp
  • A to T, chromosome 5 at 124,324,964 bp
  • T to A, chromosome 6 at 42,305,543 bp
  • G to T, chromosome 7 at 13,260,529 bp
  • C to T, chromosome 7 at 18,560,412 bp
  • T to A, chromosome 7 at 19,619,837 bp
  • T to G, chromosome 7 at 27,364,167 bp
  • T to A, chromosome 7 at 116,521,901 bp
  • G to T, chromosome 7 at 120,216,301 bp
  • C to A, chromosome 7 at 127,479,522 bp
  • T to G, chromosome 8 at 26,139,015 bp
  • A to G, chromosome 9 at 39,184,766 bp
  • A to T, chromosome 9 at 40,304,484 bp
  • T to C, chromosome 9 at 44,681,526 bp
  • A to C, chromosome 9 at 109,287,003 bp
  • A to T, chromosome 9 at 123,392,827 bp
  • TGTCACAGGT to TGT, chromosome 10 at 80,866,069 bp
  • A to G, chromosome 10 at 82,867,607 bp
  • T to G, chromosome 11 at 55,011,752 bp
  • A to G, chromosome 11 at 60,743,051 bp
  • A to G, chromosome 11 at 61,370,229 bp
  • G to A, chromosome 11 at 68,951,112 bp
  • A to G, chromosome 11 at 72,981,939 bp
  • A to T, chromosome 11 at 94,548,274 bp
  • A to T, chromosome 11 at 101,295,404 bp
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp
  • T to G, chromosome 12 at 103,628,804 bp
  • T to A, chromosome 12 at 117,911,029 bp
  • T to A, chromosome 13 at 24,717,668 bp
  • C to T, chromosome 13 at 59,600,947 bp
  • T to A, chromosome 14 at 30,518,942 bp
  • C to A, chromosome 14 at 55,594,939 bp
  • T to A, chromosome 15 at 37,270,668 bp
  • C to A, chromosome 15 at 79,485,719 bp
  • A to G, chromosome 16 at 19,769,597 bp
  • A to G, chromosome 17 at 32,524,094 bp
  • A to T, chromosome 17 at 46,672,410 bp
  • A to G, chromosome 18 at 9,214,474 bp
  • A to G, chromosome 18 at 20,340,542 bp
  • A to T, chromosome 18 at 25,158,308 bp
  • C to T, chromosome 18 at 37,335,784 bp
  • A to T, chromosome 19 at 3,467,216 bp
  • A to G, chromosome 19 at 10,941,016 bp
  • A to T, chromosome 19 at 22,978,588 bp
  • C to G, chromosome 19 at 30,100,812 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8818 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068651-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.