Strain Name:
C57BL/6J-MtgxR8819Btlr/Mmmh
Stock Number:
068652-MU
Citation ID:
RRID:MMRRC_068652-MU
Other Names:
R8819 (G1)
Major Collection:

Strain Information

Npr1
Name: natriuretic peptide receptor 1
Synonyms: guanylyl cyclase-A, NPRA, GC-A, NPR-A
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18160
HGNC: HGNC:7943
Homologene: 37367
Ldb2
Name: LIM domain binding 2
Synonyms: CLIM1, CLIM-1a, CLIM-1b, Ldb3, CLP-36
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16826
HGNC: HGNC:6533
Homologene: 989
Dnmbp
Name: dynamin binding protein
Synonyms: Tuba, 2410003L07Rik, 2410003M15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71972
Homologene: 9061
Sema4b
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
Synonyms: Semac, SemC
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20352
Homologene: 8426
Relch
Name: RAB11 binding and LisH domain, coiled-coil and HEAT repeat containing
Synonyms: 2310035C23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227446
Homologene: 10834
Eef1b2
Name: eukaryotic translation elongation factor 1 beta 2
Synonyms: 2810017J07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 55949
HGNC: HGNC:3208
Homologene: 1480
Ncor2
Name: nuclear receptor co-repressor 2
Synonyms: SMRT, SMRTe
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20602
HGNC: HGNC:7673
Homologene: 31370
Huwe1
Name: HECT, UBA and WWE domain containing 1
Synonyms: Mule, C430014N20Rik, Arf-bp1, LOC382250, 5430439H10Rik, Ureb1, Ib772
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 59026
Homologene: 45994
Rock1
Name: Rho-associated coiled-coil containing protein kinase 1
Synonyms: Rock-I, 1110055K06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19877
VEGA: 18
Homologene: 55899
Frem1
Name: Fras1 related extracellular matrix protein 1
Synonyms: heb, eyem02Jus, eyes2, QBRICK, crf11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329872
Homologene: 27049
Abca17
Name: ATP-binding cassette, sub-family A member 17
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381072
Homologene: 86807
Serinc5
Name: serine incorporator 5
Synonyms: AIGP3, A130038L21Rik, TPO1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218442
VEGA: 13
Homologene: 65246
Arhgap33
Name: Rho GTPase activating protein 33
Synonyms: Tcgap, Snx26, NOMA-GAP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233071
Homologene: 76448
Midn
Name: midnolin
Synonyms: 3000003C15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 59090
Homologene: 32510
Mctp2
Name: multiple C2 domains, transmembrane 2
Synonyms: LOC244049
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244049
Homologene: 69254
Eif1ad8
Name: eukaryotic translation initiation factor 1A domain containing 8
Synonyms: Gm8300
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 666806
Homologene: 103865
Cngb1
Name: cyclic nucleotide gated channel beta 1
Synonyms: BC016201, Cngb1, Cngb1b
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 333329
HGNC: HGNC:2151
Homologene: 136420
Rapgef3
Name: Rap guanine nucleotide exchange factor (GEF) 3
Synonyms: Epac1, 2310016P22Rik, 9330170P05Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223864
Homologene: 21231
Ddr2
Name: discoidin domain receptor family, member 2
Synonyms: Ntrkr3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18214
HGNC: HGNC:2731
Homologene: 68505
Rel
Name: reticuloendotheliosis oncogene
Synonyms: c-Rel
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19696
HGNC: HGNC:9954
Homologene: 2182
Pcsk2
Name: proprotein convertase subtilisin/kexin type 2
Synonyms: prohormone convertase 2, Phpp-2, 6330411F23Rik, PC2, SPC2, Nec2, Nec-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18549
HGNC: HGNC:8744
Homologene: 37640
Pdzph1
Name: PDZ and pleckstrin homology domains 1
Synonyms: 2610034M16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69239
Homologene: 130756
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Peli2
Name: pellino 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 93834
VEGA: 14
HGNC: HGNC:8828
Homologene: 41431
Fbll1
Name: fibrillarin-like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237730
Homologene: 28185
Cps1
Name: carbamoyl-phosphate synthetase 1
Synonyms: CPS, 4732433M03Rik, CPSase I, D1Ucla3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227231
HGNC: HGNC:2323
Homologene: 68208
Als2cl
Name: ALS2 C-terminal like
Synonyms: D930044G19Rik, mRn.49018
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235633
Homologene: 17152
Hps1
Name: HPS1, biogenesis of lysosomal organelles complex 3 subunit 1
Synonyms: 6030422N11Rik, Hermansky-Pudlak syndrome 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 192236
HGNC: HGNC:5163
Homologene: 163
Zfp27
Name: zinc finger protein 27
Synonyms: Zfp-27, mkr-4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22689
Homologene: 81823
Dsel
Name: dermatan sulfate epimerase-like
Synonyms: 9330132E09Rik, DS-epi2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319901
Homologene: 12964
Fktn
Name: fukutin
Synonyms: Fukutin, Fcmd
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 246179
HGNC: HGNC:3622
Homologene: 31402
Rimbp3
Name: RIMS binding protein 3
Synonyms: LOC385766, LOC239731, RIM-BP3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239731
Homologene: 77940
Scn11a
Name: sodium channel, voltage-gated, type XI, alpha
Synonyms: NaN, NSS2, SNS2, NaT
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24046
VEGA: 9
Homologene: 8041
Zfp438
Name: zinc finger protein 438
Synonyms: 9430091M14Rik, B830013J05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240186
VEGA: 18
Homologene: 18695
Gabrb3
Name: GABRB3, gamma-aminobutyric acid type A receptor subunit beta 3
Synonyms: A230092K12Rik, beta3, Gabrb-3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14402
HGNC: HGNC:4083
Homologene: 633
Dapl1
Name: death associated protein-like 1
Synonyms: EEDA, 2310032F03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76747
Homologene: 18947
Or52n3
Name: olfactory receptor family 52 subfamily N member 3
Synonyms: GA_x6K02T2PBJ9-7509539-7510489, MOR34-7, Olfr665
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258810
Homologene: 110477
Fbxw17
Name: F-box and WD-40 domain protein 17
Synonyms: 1110064L07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109082
Homologene: 82571
Serinc2
Name: serine incorporator 2
Synonyms: 2310004K20Rik, Tde2l, TDE2, FKSG84
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230779
Homologene: 27797
Cyp2u1
Name: cytochrome P450, family 2, subfamily u, polypeptide 1
Synonyms: 8430436A10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71519
Homologene: 77704
Npm2
Name: nucleophosmin/nucleoplasmin 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328440
VEGA: 14
HGNC: HGNC:7930
Homologene: 15349
Gimap9
Name: GTPase, IMAP family member 9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 317758
Homologene: 115637
Or2w2
Name: olfactory receptor family 2 subfamily W member 2
Synonyms: Olfr1364, GA_x6K02T2QHY8-11663090-11664010, MOR256-13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 258533
Homologene: 64885
Paip2b
Name: poly(A) binding protein interacting protein 2B
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232164
Homologene: 25798
Lmcd1
Name: LIM and cysteine-rich domains 1
Synonyms: dyxin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30937
HGNC: HGNC:6633
Homologene: 22823
Prelp
Name: proline arginine-rich end leucine-rich repeat
Synonyms: SLRR2A, 7330409J17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 116847
HGNC: HGNC:9357
Homologene: 2041
Cracd
Name: capping protein inhibiting regulator of actin
Synonyms: C530008M17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320827
Homologene: 136278
Lypd9
Name: LY6/PLAUR domain containing 9
Synonyms: 4930504O13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 403200
Homologene: 87298
Clk2
Name: CDC-like kinase 2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12748
HGNC: HGNC:2069
Homologene: 33303
Bag5
Name: BCL2-associated athanogene 5
Synonyms: 4930405J06Rik, 1600025G07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70369
HGNC: HGNC:941
Homologene: 3584
Ift46
Name: intraflagellar transport 46
Synonyms: IFT46, 1500035H01Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76568
Homologene: 10596
Or6e1
Name: olfactory receptor family 6 subfamily E member 1
Synonyms: IC6, GA_x6K02T2QVSB-39745261-39746202, Olfr49, MOR118-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18348
Homologene: 106373
Tnfsf10
Name: tumor necrosis factor (ligand) superfamily, member 10
Synonyms: A330042I21Rik, Trail, APO-2L
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22035
Homologene: 2824
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 63,178,109 bp
  • T to A, chromosome 1 at 67,228,280 bp
  • T to A, chromosome 1 at 105,726,454 bp
  • A to G, chromosome 1 at 111,860,264 bp
  • T to C, chromosome 1 at 133,915,140 bp
  • T to A, chromosome 1 at 169,977,914 bp
  • T to C, chromosome 2 at 59,504,712 bp
  • G to A, chromosome 2 at 112,635,792 bp
  • A to G, chromosome 2 at 112,859,724 bp
  • T to A, chromosome 2 at 143,801,070 bp
  • G to A, chromosome 3 at 27,335,302 bp
  • T to A, chromosome 3 at 89,175,423 bp
  • G to A, chromosome 3 at 90,464,894 bp
  • T to C, chromosome 3 at 131,298,367 bp
  • T to C, chromosome 4 at 53,735,001 bp
  • C to A, chromosome 4 at 82,903,517 bp
  • C to A, chromosome 4 at 130,255,379 bp
  • G to A, chromosome 5 at 44,799,415 bp
  • CTGAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAG to C, chromosome 5 at 76,856,946 bp
  • A to G, chromosome 5 at 125,029,227 bp
  • A to G, chromosome 6 at 48,677,887 bp
  • A to C, chromosome 6 at 83,814,756 bp
  • T to A, chromosome 6 at 112,329,809 bp
  • T to C, chromosome 7 at 29,894,588 bp
  • T to C, chromosome 7 at 30,528,740 bp
  • T to C, chromosome 7 at 57,792,581 bp
  • C to A, chromosome 7 at 72,229,333 bp
  • G to C, chromosome 7 at 80,220,500 bp
  • T to A, chromosome 7 at 104,881,655 bp
  • C to T, chromosome 8 at 95,253,409 bp
  • C to T, chromosome 9 at 44,790,522 bp
  • T to C, chromosome 9 at 110,885,787 bp
  • T to C, chromosome 9 at 119,816,520 bp
  • T to G, chromosome 10 at 80,154,400 bp
  • C to T, chromosome 11 at 23,745,626 bp
  • T to C, chromosome 11 at 35,797,975 bp
  • T to G, chromosome 11 at 58,446,303 bp
  • C to T, chromosome 12 at 87,517,140 bp
  • T to C, chromosome 12 at 111,711,275 bp
  • G to A, chromosome 13 at 21,573,829 bp
  • A to T, chromosome 13 at 50,433,315 bp
  • G to T, chromosome 13 at 92,708,036 bp
  • G to A, chromosome 14 at 48,252,673 bp
  • C to T, chromosome 14 at 54,282,613 bp
  • A to G, chromosome 14 at 70,648,328 bp
  • T to C, chromosome 15 at 97,748,657 bp
  • T to C, chromosome 16 at 17,210,907 bp
  • A to G, chromosome 17 at 24,328,602 bp
  • G to C, chromosome 17 at 58,880,720 bp
  • A to G, chromosome 18 at 5,213,383 bp
  • A to G, chromosome 18 at 10,070,626 bp
  • T to C, chromosome 19 at 42,771,209 bp
  • C to T, chromosome 19 at 43,901,415 bp
  • A to G, chromosome X at 151,886,997 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8819 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068652-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.