Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8853Btlr/Mmmh
Stock Number:
068675-MU
Citation ID:
RRID:MMRRC_068675-MU
Other Names:
R8853 (G1)
Major Collection:

Strain Information

Rasgrp2
Name: RAS, guanyl releasing protein 2
Synonyms: CalDAG-GEFI, Caldaggef1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19395
HGNC: HGNC:9879
Homologene: 4250
Arpp21
Name: cyclic AMP-regulated phosphoprotein, 21
Synonyms: ARPP-21, Tarpp, D9Bwg1012e, 0710001E13Rik, R3hdm3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74100
Homologene: 32306
Elp3
Name: elongator acetyltransferase complex subunit 3
Synonyms: 2610507P14Rik, KAT9
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74195
VEGA: 14
Homologene: 7105
Ndnf
Name: neuron-derived neurotrophic factor
Synonyms: epidermacan, A930038C07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68169
Homologene: 11593
Pvr
Name: poliovirus receptor
Synonyms: mE4, 3830421F03Rik, Taa1, CD155, Tage4, necl-5, D7Ertd458e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 52118
HGNC: HGNC:9705
Homologene: 79541
Eif3b
Name: eukaryotic translation initiation factor 3, subunit B
Synonyms: EIF3-P116, D5Wsu45e, Eif3s9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27979
HGNC: HGNC:3280
Homologene: 2780
Rnf34
Name: ring finger protein 34
Synonyms: phafin 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80751
Homologene: 11839
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 20,073,455 bp
  • A to T, chromosome 1 at 150,671,975 bp
  • T to C, chromosome 1 at 174,100,295 bp
  • G to T, chromosome 2 at 145,876,555 bp
  • T to C, chromosome 3 at 63,781,546 bp
  • T to A, chromosome 3 at 85,871,780 bp
  • T to A, chromosome 4 at 43,912,089 bp
  • T to A, chromosome 4 at 127,195,017 bp
  • A to T, chromosome 5 at 36,629,680 bp
  • G to A, chromosome 5 at 37,303,303 bp
  • T to C, chromosome 5 at 122,864,024 bp
  • G to A, chromosome 5 at 140,440,019 bp
  • G to C, chromosome 6 at 30,826,180 bp
  • A to G, chromosome 6 at 40,464,266 bp
  • A to T, chromosome 6 at 48,906,060 bp
  • C to A, chromosome 6 at 65,703,177 bp
  • A to T, chromosome 6 at 83,773,745 bp
  • G to A, chromosome 6 at 125,657,264 bp
  • A to T, chromosome 7 at 12,581,810 bp
  • A to T, chromosome 7 at 12,615,855 bp
  • A to G, chromosome 7 at 14,491,716 bp
  • A to G, chromosome 7 at 19,369,968 bp
  • A to G, chromosome 7 at 19,916,972 bp
  • A to T, chromosome 7 at 23,418,300 bp
  • A to T, chromosome 7 at 24,123,965 bp
  • A to G, chromosome 7 at 26,757,220 bp
  • A to G, chromosome 7 at 29,161,990 bp
  • G to A, chromosome 7 at 44,616,254 bp
  • A to G, chromosome 7 at 122,173,744 bp
  • G to A, chromosome 8 at 21,940,790 bp
  • A to G, chromosome 8 at 47,529,404 bp
  • A to G, chromosome 8 at 48,342,347 bp
  • A to G, chromosome 8 at 84,727,647 bp
  • C to G, chromosome 8 at 119,462,600 bp
  • A to T, chromosome 9 at 7,117,645 bp
  • A to G, chromosome 9 at 21,194,823 bp
  • A to G, chromosome 9 at 101,212,911 bp
  • T to G, chromosome 9 at 112,147,448 bp
  • C to T, chromosome 9 at 120,461,421 bp
  • G to C, chromosome 10 at 96,021,655 bp
  • G to A, chromosome 10 at 114,800,925 bp
  • A to G, chromosome 11 at 16,908,885 bp
  • T to C, chromosome 11 at 68,992,918 bp
  • A to G, chromosome 11 at 74,407,372 bp
  • C to T, chromosome 12 at 17,301,147 bp
  • A to G, chromosome 12 at 104,389,655 bp
  • T to C, chromosome 13 at 9,690,929 bp
  • ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC to ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC, chromosome 13 at 117,975,733 bp
  • C to A, chromosome 14 at 20,661,374 bp
  • C to T, chromosome 14 at 48,256,488 bp
  • T to A, chromosome 14 at 49,073,880 bp
  • T to C, chromosome 14 at 55,826,233 bp
  • T to A, chromosome 14 at 65,577,941 bp
  • T to A, chromosome 16 at 19,947,229 bp
  • T to A, chromosome 17 at 23,175,717 bp
  • A to G, chromosome 17 at 34,729,905 bp
  • A to T, chromosome 17 at 50,606,856 bp
  • A to G, chromosome 18 at 31,986,691 bp
  • A to G, chromosome 19 at 6,414,825 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8853 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068675-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.