MMRRC:068684-MU

G to A, chromosome 1 at 16,066,227 bp
G to A, chromosome 1 at 40,525,120 bp
A to G, chromosome 1 at 69,683,258 bp
T to A, chromosome 1 at 69,996,858 bp
T to C, chromosome 1 at 104,945,323 bp
A to G, chromosome 1 at 164,137,218 bp
G to T, chromosome 1 at 178,865,029 bp
A to G, chromosome 1 at 180,332,179 bp
C to T, chromosome 2 at 28,735,590 bp
A to G, chromosome 2 at 31,048,210 bp
G to A, chromosome 2 at 36,105,220 bp
A to G, chromosome 2 at 37,068,970 bp
A to G, chromosome 2 at 52,161,469 bp
T to A, chromosome 2 at 110,783,729 bp
T to A, chromosome 2 at 111,270,119 bp
A to G, chromosome 2 at 155,421,158 bp
T to C, chromosome 2 at 156,078,953 bp
T to A, chromosome 2 at 177,265,519 bp
A to G, chromosome 3 at 37,448,512 bp
G to T, chromosome 4 at 100,897,781 bp
C to T, chromosome 4 at 103,087,332 bp
A to T, chromosome 4 at 134,091,214 bp
A to G, chromosome 5 at 24,387,034 bp
C to A, chromosome 5 at 38,320,404 bp
A to T, chromosome 5 at 76,235,785 bp
A to T, chromosome 5 at 113,738,187 bp
A to T, chromosome 6 at 4,754,825 bp
T to A, chromosome 6 at 66,716,736 bp
A to G, chromosome 6 at 108,388,211 bp
A to T, chromosome 6 at 113,686,941 bp
A to G, chromosome 6 at 132,951,559 bp
G to T, chromosome 6 at 142,298,876 bp
A to G, chromosome 7 at 13,052,909 bp
A to T, chromosome 7 at 23,835,055 bp
A to G, chromosome 7 at 28,459,493 bp
A to T, chromosome 7 at 28,739,936 bp
A to C, chromosome 7 at 43,675,322 bp
T to C, chromosome 7 at 67,240,428 bp
A to G, chromosome 7 at 128,101,513 bp
A to T, chromosome 8 at 33,329,192 bp
A to G, chromosome 8 at 34,847,279 bp
A to G, chromosome 9 at 38,378,424 bp
A to G, chromosome 9 at 39,426,252 bp
A to T, chromosome 9 at 48,603,501 bp
G to T, chromosome 9 at 76,246,384 bp
A to G, chromosome 9 at 88,413,488 bp
T to A, chromosome 9 at 110,594,253 bp
T to A, chromosome 9 at 123,963,985 bp
A to T, chromosome 10 at 18,138,860 bp
A to G, chromosome 10 at 39,862,790 bp
A to G, chromosome 10 at 80,150,105 bp
T to C, chromosome 10 at 91,151,719 bp
C to A, chromosome 11 at 30,891,860 bp
T to A, chromosome 11 at 49,444,523 bp
A to G, chromosome 11 at 69,825,471 bp
A to T, chromosome 11 at 73,340,265 bp
T to G, chromosome 11 at 73,906,899 bp
GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC to GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC, chromosome 11 at 96,099,982 bp
A to G, chromosome 11 at 98,029,789 bp
A to G, chromosome 11 at 104,900,674 bp
A to G, chromosome 12 at 90,204,786 bp
T to A, chromosome 12 at 120,018,533 bp
T to C, chromosome 13 at 64,921,004 bp
A to T, chromosome 13 at 77,323,721 bp
A to G, chromosome 13 at 104,230,857 bp
C to T, chromosome 14 at 25,757,154 bp
C to T, chromosome 14 at 50,791,993 bp
T to A, chromosome 14 at 62,332,168 bp
A to T, chromosome 14 at 69,038,376 bp
A to G, chromosome 15 at 79,255,907 bp
A to C, chromosome 16 at 23,496,132 bp
A to G, chromosome 16 at 33,214,480 bp
G to A, chromosome 16 at 59,185,767 bp
A to T, chromosome 17 at 18,305,058 bp
A to C, chromosome 17 at 46,470,735 bp
A to G, chromosome 18 at 12,188,561 bp
A to T, chromosome 18 at 67,640,120 bp
A to G, chromosome 19 at 6,314,520 bp
T to C, chromosome 19 at 8,847,429 bp
G to A, chromosome 19 at 53,371,695 bp

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain GQC Summary

Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice

Littermates of all relevant genotypes.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R8870 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
068684-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Information Expand All