Strain Name:
C57BL/6J-MtgxR8870Btlr/Mmmh
Stock Number:
068684-MU
Citation ID:
RRID:MMRRC_068684-MU
Other Names:
R8870 (G1)
Major Collection:

Strain Information

Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Lhx6
Name: LIM homeobox protein 6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16874
Homologene: 7401
Drd5
Name: dopamine receptor D5
Synonyms: DRD1b, Drd-5, Gpcr1, Drd1b, D5R
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13492
HGNC: HGNC:3026
Homologene: 20216
Tnks
Name: tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms: 4930554K12Rik, D130072O21Rik, tankyrase 1, TANK1, mTNKS1, Parp5a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21951
Homologene: 18405
Setd2
Name: SET domain containing 2
Synonyms: 4921524K10Rik, KMT3A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235626
Homologene: 56493
Cpne1
Name: copine I
Synonyms: 1810028N16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 266692
HGNC: HGNC:2314
Homologene: 36501
Afg2a
Name: AFG2 AAA ATPase homolog A
Synonyms: 2510048F20Rik, Spaf, C78064, Spata5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 57815
Homologene: 56920
Fnbp1
Name: formin binding protein 1
Synonyms: FBP1, FBP17, 2210010H06Rik, 1110057E06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14269
Homologene: 100983
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: P400, IP3R1, Pcp-1, Itpr-1, Ip3r, opt, InsP3R type I, Pcp1, wblo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
Osbpl11
Name: oxysterol binding protein-like 11
Synonyms: ORP-11
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106326
Homologene: 23385
Cdc42bpg
Name: CDC42 binding protein kinase gamma
Synonyms: MRCKgamma
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240505
Homologene: 28384
Clock
Name: clock circadian regulator
Synonyms: 5330400M04Rik, KAT13D, bHLHe8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12753
HGNC: HGNC:2082
Homologene: 3603
Mxi1
Name: MAX interactor 1, dimerization protein
Synonyms: Mad2, bHLHc11
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17859
VEGA: 19
HGNC: HGNC:7534
Homologene: 4351
Mef2a
Name: myocyte enhancer factor 2A
Synonyms: A430079H05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17258
HGNC: HGNC:6993
Homologene: 4080
Midn
Name: midnolin
Synonyms: 3000003C15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 59090
Homologene: 32510
Cep76
Name: centrosomal protein 76
Synonyms: 6230425F05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225659
VEGA: 18
Homologene: 11774
Cenpk
Name: centromere protein K
Synonyms: C530004N04Rik, B130045K24Rik, Solt
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 60411
VEGA: 13
Homologene: 11035
Cachd1
Name: cache domain containing 1
Synonyms: 1190007F10Rik, Vwcd1, B430218L07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320508
Homologene: 10854
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Ccr1
Name: C-C motif chemokine receptor 1
Synonyms: Cmkbr1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12768
VEGA: 9
HGNC: HGNC:1602
Homologene: 20344
Irak2
Name: interleukin-1 receptor-associated kinase 2
Synonyms: 6330415L08Rik, IRAK-2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108960
HGNC: HGNC:6113
Homologene: 1207
Itpkb
Name: inositol 1,4,5-trisphosphate 3-kinase B
Synonyms: 1110033J02Rik, E130307H12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320404
HGNC: HGNC:6179
Homologene: 1672
Nlgn2
Name: neuroligin 2
Synonyms: NL2, NLG2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216856
Homologene: 69317
Spata31
Name: spermatogenesis associated 31
Synonyms: Spata31a, Fam75a, 4930458L03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 78124
Homologene: 84621
Ncoa6
Name: nuclear receptor coactivator 6
Synonyms: PRIP, ASC2, RAP250, AIB3, NRC, ASC-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56406
Homologene: 137337
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Or1e35
Name: olfactory receptor family 1 subfamily E member 35
Synonyms: GA_x6K02T2P1NL-4062605-4061667, MOR135-10, Olfr395
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259007
Gm11639
Name: predicted gene 11639
Synonyms: Gm11639, Efcab15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 105242472
Ect2l
Name: epithelial cell transforming sequence 2 oncogene-like
Synonyms: Gm10331, C330021H03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100045792
Homologene: 46005
Hcrtr2
Name: hypocretin (orexin) receptor 2
Synonyms: OX2r, mOX2bR, mOX2aR, mOXR2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 387285
HGNC: HGNC:4849
Homologene: 1168
Atg9b
Name: autophagy related 9B
Synonyms: LOC213948, eONE, Apg9l2, Nos3as
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 213948
Homologene: 72638
Gpr75
Name: G protein-coupled receptor 75
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237716
HGNC: HGNC:4526
Homologene: 4945
Vmn2r93
Name: vomeronasal 2, receptor 93
Synonyms: EG627132
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627132
Homologene: 129750
Rev3l
Name: REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms: Sez4, Rev
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19714
HGNC: HGNC:9968
Homologene: 48147
Or8g33
Name: olfactory receptor family 8 subfamily G member 33
Synonyms: GA_x6K02T2PVTD-33124064-33123120, MOR171-21, Olfr952
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235248
VEGA: 9
Homologene: 133698
Ccnb1ip1
Name: cyclin B1 interacting protein 1
Synonyms: LOC239083, mei4, Hei10
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239083
VEGA: 14
Homologene: 18819
Dnai4
Name: dynein axonemal intermediate chain 4
Synonyms: Wdr78
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242584
Homologene: 11702
Spag16
Name: sperm associated antigen 16
Synonyms: Pf20, 4930524F24Rik, 4930585K05Rik, Wdr29, 4921511D23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66722
Homologene: 11572
Crybg2
Name: crystallin beta-gamma domain containing 2
Synonyms: Aim1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230806
Homologene: 19232
Nrxn3
Name: neurexin III
Synonyms: neurexin III beta, neurexin III alpha, neurexin III beta, neurexin III alpha, 9330112C09Rik, D12Bwg0831e, 4933401A11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18191
HGNC: HGNC:8010
Homologene: 83225
Masp1
Name: MBL associated serine protease 1
Synonyms: Crarf
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17174
VEGA: 16
HGNC: HGNC:6901
Homologene: 88793
Or4k35
Name: olfactory receptor family 4 subfamily K member 35
Synonyms: GA_x6K02T2Q125-72321818-72320907, MOR248-11, Olfr1277
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258391
Homologene: 105176
Tmpo
Name: thymopoietin
Synonyms: TP, 5630400D24Rik, LAP2, lamina-associated polypeptide 2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21917
VEGA: 10
Homologene: 31144
Il18rap
Name: interleukin 18 receptor accessory protein
Synonyms: AcPL accessory protein-like)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16174
HGNC: HGNC:5989
Homologene: 2859
Kif26b
Name: kinesin family member 26B
Synonyms: N-11 kinesin, D230039L06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269152
Homologene: 18623
Ficd
Name: FIC domain containing
Synonyms: D5Ertd40e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231630
Homologene: 5139
Spata22
Name: spermatogenesis associated 22
Synonyms: LOC380709
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380709
Homologene: 13076
Rmc1
Name: regulator of MON1-CCZ1
Synonyms: 3110002H16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 76482
Homologene: 8341
Ttbk1
Name: tau tubulin kinase 1
Synonyms: C330008L01Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106763
VEGA: 17
Homologene: 50342
Snx14
Name: sorting nexin 14
Synonyms: YR-14, C330035N22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244962
Homologene: 17823
Cdh20
Name: cadherin 20
Synonyms: Cdh7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23836
HGNC: HGNC:1760
Homologene: 8015
Bscl2
Name: BSCL2 lipid droplet biogenesis associated, seipin
Synonyms: seipin, Gng3lg
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14705
Homologene: 32032
Vmn1r176
Name: vomeronasal 1 receptor 176
Synonyms: Gm5998
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546943
Homologene: 128341
2210408I21Rik
Name: RIKEN cDNA 2210408I21 gene
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72371
Homologene: 89234
Nnmt
Name: nicotinamide N-methyltransferase
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18113
HGNC: HGNC:7861
Homologene: 4496
Or8c11
Name: olfactory receptor family 8 subfamily C member 11
Synonyms: GA_x6K02T2MYUG-9124-8183, MOR170-15, Olfr251, MOR170-13, MOR170-2, GA_x6K02T2PVTD-32071567-32072508, Olfr900
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 404313
VEGA: 9
Homologene: 133654
Stc1
Name: stanniocalcin 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20855
VEGA: 14
Homologene: 2374
Rpl19
Name: ribosomal protein L19
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19921
Homologene: 68105
Ano3
Name: anoctamin 3
Synonyms: B230324K02Rik, Tmem16c
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228432
Homologene: 57147
Tas2r129
Name: taste receptor, type 2, member 129
Synonyms: T2R29, Tas2r29, mGR29, mt2r60
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387354
Homologene: 130074
Ak8
Name: adenylate kinase 8
Synonyms: 1190002A17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68870
Homologene: 17622
Ctu1
Name: cytosolic thiouridylase subunit 1
Synonyms: Atpbd3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233189
Homologene: 102140
Vmn1r36
Name: vomeronasal 1 receptor 36
Synonyms: V1rc11
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171184
Homologene: 110800
Calcoco2
Name: calcium binding and coiled-coil domain 2
Synonyms: 2410154J16Rik, Ndp52l1, Ndp52
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76815
Mzf1
Name: myeloid zinc finger 1
Synonyms: Znf42, Mzf2, Zfp121, Zfp98
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 109889
Homologene: 9633
Zcchc24
Name: zinc finger, CCHC domain containing 24
Synonyms: 2310047A01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71918
Homologene: 66746
Ikzf2
Name: IKAROS family zinc finger 2
Synonyms: Helios, Zfpn1a2, A730095J18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22779
Homologene: 22659
Lrfn1
Name: leucine rich repeat and fibronectin type III domain containing 1
Synonyms: SALM2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80749
Homologene: 12729
Rnaseh2b
Name: ribonuclease H2, subunit B
Synonyms: 2610207P08Rik, Dleu8, 1110019N06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67153
Homologene: 41572
Or2y16
Name: olfactory receptor family 2 subfamily Y member 16
Synonyms: GA_x6K02T2QP88-5991012-5990077, MOR256-28, Olfr1388
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258459
Homologene: 74258
Zfp1010
Name: zinc finger protein 1010
Synonyms: Gm14409
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 115489547
Selp
Name: selectin, platelet
Synonyms: CD62P, P-selectin, Grmp
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20344
Homologene: 2260
Pick1
Name: protein interacting with C kinase 1
Synonyms: Prkcabp
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18693
HGNC: HGNC:9394
Homologene: 7470
4930444P10Rik
Name: RIKEN cDNA 4930444P10 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75799
Homologene: 90802
Iapp
Name: islet amyloid polypeptide
Synonyms: amylin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15874
HGNC: HGNC:5329
Homologene: 36024
Mrps12
Name: mitochondrial ribosomal protein S12
Synonyms: rps12, mitoribosomal protein s12, Rpms12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 24030
Homologene: 6848
Or12k7
Name: olfactory receptor family 12 subfamily K member 7
Synonyms: GA_x6K02T2NLDC-33760081-33761034, MOR159-1, Olfr360
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258615
Homologene: 73997
Or5h27
Name: olfactory receptor family 5 subfamily H member 27, pseudogene 1
Synonyms: GA_x54KRFPKG5P-55400292-55399363, MOR183-3, Olfr197
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258477
Homologene: 36984
Gm49368
Name: predicted gene, 49368
Type: Gene
Species: Mouse
Chromosome: 7
Tmem196
Name: transmembrane protein 196
Synonyms: LOC217951
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217951
Homologene: 27397
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 16,066,227 bp
  • G to A, chromosome 1 at 40,525,120 bp
  • A to G, chromosome 1 at 69,683,258 bp
  • T to A, chromosome 1 at 69,996,858 bp
  • T to C, chromosome 1 at 104,945,323 bp
  • A to G, chromosome 1 at 164,137,218 bp
  • G to T, chromosome 1 at 178,865,029 bp
  • A to G, chromosome 1 at 180,332,179 bp
  • C to T, chromosome 2 at 28,735,590 bp
  • A to G, chromosome 2 at 31,048,210 bp
  • G to A, chromosome 2 at 36,105,220 bp
  • A to G, chromosome 2 at 37,068,970 bp
  • A to G, chromosome 2 at 52,161,469 bp
  • T to A, chromosome 2 at 110,783,729 bp
  • T to A, chromosome 2 at 111,270,119 bp
  • A to G, chromosome 2 at 155,421,158 bp
  • T to C, chromosome 2 at 156,078,953 bp
  • T to A, chromosome 2 at 177,265,519 bp
  • A to G, chromosome 3 at 37,448,512 bp
  • G to T, chromosome 4 at 100,897,781 bp
  • C to T, chromosome 4 at 103,087,332 bp
  • A to T, chromosome 4 at 134,091,214 bp
  • A to G, chromosome 5 at 24,387,034 bp
  • C to A, chromosome 5 at 38,320,404 bp
  • A to T, chromosome 5 at 76,235,785 bp
  • A to T, chromosome 5 at 113,738,187 bp
  • A to T, chromosome 6 at 4,754,825 bp
  • T to A, chromosome 6 at 66,716,736 bp
  • A to G, chromosome 6 at 108,388,211 bp
  • A to T, chromosome 6 at 113,686,941 bp
  • A to G, chromosome 6 at 132,951,559 bp
  • G to T, chromosome 6 at 142,298,876 bp
  • A to G, chromosome 7 at 13,052,909 bp
  • A to T, chromosome 7 at 23,835,055 bp
  • A to G, chromosome 7 at 28,459,493 bp
  • A to T, chromosome 7 at 28,739,936 bp
  • A to C, chromosome 7 at 43,675,322 bp
  • T to C, chromosome 7 at 67,240,428 bp
  • A to G, chromosome 7 at 128,101,513 bp
  • A to T, chromosome 8 at 33,329,192 bp
  • A to G, chromosome 8 at 34,847,279 bp
  • A to G, chromosome 9 at 38,378,424 bp
  • A to G, chromosome 9 at 39,426,252 bp
  • A to T, chromosome 9 at 48,603,501 bp
  • G to T, chromosome 9 at 76,246,384 bp
  • A to G, chromosome 9 at 88,413,488 bp
  • T to A, chromosome 9 at 110,594,253 bp
  • T to A, chromosome 9 at 123,963,985 bp
  • A to T, chromosome 10 at 18,138,860 bp
  • A to G, chromosome 10 at 39,862,790 bp
  • A to G, chromosome 10 at 80,150,105 bp
  • T to C, chromosome 10 at 91,151,719 bp
  • C to A, chromosome 11 at 30,891,860 bp
  • T to A, chromosome 11 at 49,444,523 bp
  • A to G, chromosome 11 at 69,825,471 bp
  • A to T, chromosome 11 at 73,340,265 bp
  • T to G, chromosome 11 at 73,906,899 bp
  • GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC to GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC, chromosome 11 at 96,099,982 bp
  • A to G, chromosome 11 at 98,029,789 bp
  • A to G, chromosome 11 at 104,900,674 bp
  • A to G, chromosome 12 at 90,204,786 bp
  • T to A, chromosome 12 at 120,018,533 bp
  • T to C, chromosome 13 at 64,921,004 bp
  • A to T, chromosome 13 at 77,323,721 bp
  • A to G, chromosome 13 at 104,230,857 bp
  • C to T, chromosome 14 at 25,757,154 bp
  • C to T, chromosome 14 at 50,791,993 bp
  • T to A, chromosome 14 at 62,332,168 bp
  • A to T, chromosome 14 at 69,038,376 bp
  • A to G, chromosome 15 at 79,255,907 bp
  • A to C, chromosome 16 at 23,496,132 bp
  • A to G, chromosome 16 at 33,214,480 bp
  • G to A, chromosome 16 at 59,185,767 bp
  • A to T, chromosome 17 at 18,305,058 bp
  • A to C, chromosome 17 at 46,470,735 bp
  • A to G, chromosome 18 at 12,188,561 bp
  • A to T, chromosome 18 at 67,640,120 bp
  • A to G, chromosome 19 at 6,314,520 bp
  • T to C, chromosome 19 at 8,847,429 bp
  • G to A, chromosome 19 at 53,371,695 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8870 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068684-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.