Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8886Btlr/Mmmh
Stock Number:
068691-MU
Citation ID:
RRID:MMRRC_068691-MU
Other Names:
R8886 (G1)
Major Collection:

Strain Information

Itpk1
Name: inositol 1,3,4-triphosphate 5/6 kinase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217837
HGNC: HGNC:6177
Homologene: 8588
Pcp2
Name: Purkinje cell protein 2 (L7)
Synonyms: L7, Pcp-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18545
Homologene: 7464
Nts
Name: neurotensin
Synonyms: neuromedin N, NT/N, NTS1, NMN-125, 5033428E16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67405
VEGA: 10
HGNC: HGNC:8038
Homologene: 4506
Ppp4c
Name: protein phosphatase 4, catalytic subunit
Synonyms: PPX, 1110002D08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56420
HGNC: HGNC:9319
Homologene: 2038
Cryzl1
Name: crystallin zeta like 1
Synonyms: 2210407J23Rik, 2410006O11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66609
HGNC: HGNC:2420
Homologene: 3749
Ski
Name: ski sarcoma viral oncogene homolog (avian)
Synonyms: 2610001A11Rik, 2310012I02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20481
Homologene: 31124
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 9,967,163 bp
  • A to G, chromosome 1 at 25,111,847 bp
  • T to A, chromosome 1 at 57,382,849 bp
  • C to T, chromosome 1 at 105,585,054 bp
  • T to A, chromosome 1 at 152,006,598 bp
  • A to G, chromosome 2 at 34,857,743 bp
  • A to T, chromosome 2 at 60,627,980 bp
  • C to A, chromosome 2 at 80,508,711 bp
  • T to C, chromosome 2 at 94,375,128 bp
  • G to T, chromosome 2 at 130,275,982 bp
  • T to C, chromosome 2 at 160,781,296 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • A to T, chromosome 2 at 180,932,993 bp
  • T to C, chromosome 3 at 10,344,802 bp
  • T to C, chromosome 3 at 27,145,977 bp
  • T to C, chromosome 3 at 56,058,727 bp
  • T to A, chromosome 3 at 59,329,989 bp
  • T to A, chromosome 3 at 64,287,471 bp
  • C to G, chromosome 3 at 141,803,820 bp
  • T to A, chromosome 4 at 129,951,838 bp
  • A to T, chromosome 4 at 155,159,559 bp
  • T to C, chromosome 5 at 75,183,073 bp
  • T to C, chromosome 5 at 87,336,499 bp
  • T to C, chromosome 5 at 143,714,959 bp
  • T to C, chromosome 6 at 18,414,299 bp
  • A to G, chromosome 6 at 48,481,267 bp
  • T to C, chromosome 6 at 55,278,238 bp
  • T to A, chromosome 6 at 67,840,237 bp
  • C to T, chromosome 6 at 119,913,080 bp
  • T to C, chromosome 6 at 142,600,694 bp
  • T to C, chromosome 6 at 145,417,426 bp
  • A to C, chromosome 7 at 12,321,916 bp
  • C to A, chromosome 7 at 19,091,961 bp
  • T to A, chromosome 7 at 44,219,768 bp
  • A to T, chromosome 7 at 126,787,294 bp
  • G to A, chromosome 7 at 139,007,442 bp
  • G to T, chromosome 7 at 140,004,969 bp
  • A to G, chromosome 8 at 3,625,208 bp
  • A to T, chromosome 8 at 45,321,748 bp
  • A to T, chromosome 8 at 94,172,848 bp
  • G to A, chromosome 8 at 120,570,731 bp
  • C to A, chromosome 9 at 31,097,124 bp
  • T to C, chromosome 9 at 37,417,472 bp
  • T to G, chromosome 9 at 38,595,150 bp
  • T to C, chromosome 9 at 42,367,063 bp
  • C to T, chromosome 10 at 5,604,208 bp
  • A to T, chromosome 10 at 27,369,161 bp
  • A to T, chromosome 10 at 61,686,393 bp
  • C to T, chromosome 10 at 102,485,007 bp
  • A to T, chromosome 11 at 66,053,014 bp
  • A to G, chromosome 11 at 100,422,036 bp
  • A to G, chromosome 11 at 119,288,879 bp
  • A to G, chromosome 11 at 119,473,438 bp
  • A to T, chromosome 12 at 5,137,542 bp
  • C to A, chromosome 12 at 76,564,974 bp
  • G to A, chromosome 12 at 102,584,345 bp
  • C to T, chromosome 14 at 30,895,525 bp
  • T to C, chromosome 14 at 40,873,989 bp
  • A to C, chromosome 14 at 44,504,234 bp
  • T to C, chromosome 15 at 75,893,584 bp
  • G to T, chromosome 15 at 82,065,850 bp
  • A to G, chromosome 15 at 101,528,786 bp
  • A to G, chromosome 16 at 14,234,414 bp
  • C to T, chromosome 16 at 44,499,443 bp
  • T to A, chromosome 16 at 91,695,300 bp
  • T to C, chromosome 17 at 25,234,654 bp
  • G to A, chromosome 17 at 27,118,677 bp
  • T to C, chromosome 17 at 34,037,454 bp
  • A to T, chromosome 18 at 10,553,843 bp
  • C to T, chromosome 18 at 46,311,759 bp
  • A to G, chromosome 19 at 44,241,837 bp
  • A to T, chromosome 19 at 53,813,336 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8886 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068691-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.