Strain Name:
C57BL/6J-MtgxR8886Btlr/Mmmh
Stock Number:
068691-MU
Citation ID:
RRID:MMRRC_068691-MU
Other Names:
R8886 (G1)
Major Collection:

Strain Information

Itpk1
Name: inositol 1,3,4-triphosphate 5/6 kinase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217837
HGNC: HGNC:6177
Homologene: 8588
Pcp2
Name: Purkinje cell protein 2 (L7)
Synonyms: L7, Pcp-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18545
Homologene: 7464
Nts
Name: neurotensin
Synonyms: neuromedin N, NT/N, NTS1, NMN-125, 5033428E16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67405
VEGA: 10
HGNC: HGNC:8038
Homologene: 4506
Ppp4c
Name: protein phosphatase 4, catalytic subunit
Synonyms: PPX, 1110002D08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56420
HGNC: HGNC:9319
Homologene: 2038
Cryzl1
Name: crystallin zeta like 1
Synonyms: 2210407J23Rik, 2410006O11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66609
HGNC: HGNC:2420
Homologene: 3749
Nbea
Name: neurobeachin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26422
HGNC: HGNC:7648
Homologene: 69190
Ski
Name: ski sarcoma viral oncogene homolog (avian)
Synonyms: 2610001A11Rik, 2310012I02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20481
Homologene: 31124
Sar1a
Name: secretion associated Ras related GTPase 1A
Synonyms: 1600019H17Rik, Sara1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20224
VEGA: 10
Homologene: 90897
Gse1
Name: genetic suppressor element 1, coiled-coil protein
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382034
Homologene: 40964
Ttc17
Name: tetratricopeptide repeat domain 17
Synonyms: D2Bwg1005e, 9130020K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74569
Homologene: 10100
Ect2
Name: ect2 oncogene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13605
HGNC: HGNC:3155
Homologene: 7298
Nckap1
Name: NCK-associated protein 1
Synonyms: mh19, Hem-2, H19, Nap1, Hem2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50884
HGNC: HGNC:7666
Homologene: 8384
Nop56
Name: NOP56 ribonucleoprotein
Synonyms: NOP56, 56kDa with KKE/D repeat, 2310044F10Rik, Nol5a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67134
Homologene: 4660
Eif4a3
Name: eukaryotic translation initiation factor 4A3
Synonyms: 2400003O03Rik, Ddx48
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192170
Homologene: 5602
Rxrb
Name: retinoid X receptor beta
Synonyms: RCoR-1, H-2RIIBP, Nr2b2, Rub
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20182
Homologene: 7923
Robo3
Name: roundabout guidance receptor 3
Synonyms: Rig-1, Rbig1, Robo3b, Robo3a, Rig1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19649
Homologene: 32119
Boc
Name: BOC cell adhesion associated, oncogene regulated
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 117606
Homologene: 32819
Rad52
Name: RAD52 homolog, DNA repair protein
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19365
HGNC: HGNC:9824
Homologene: 31118
St14
Name: suppression of tumorigenicity 14 (colon carcinoma)
Synonyms: Prss14, Epithin, MT-SP1, matriptase, Tmprss14
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19143
Homologene: 7906
Tubgcp2
Name: tubulin, gamma complex component 2
Synonyms: 1700022B05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74237
Homologene: 55980
Usp42
Name: ubiquitin specific peptidase 42
Synonyms: 3110031A07Rik, 2410140K03Rik, D5Ertd591e, A630018G05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76800
Homologene: 35425
Itpr3
Name: inositol 1,4,5-triphosphate receptor 3
Synonyms: Itpr-3, Ip3r3, tf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16440
HGNC: HGNC:6182
Homologene: 1675
Pdgfra
Name: platelet derived growth factor receptor, alpha polypeptide
Synonyms: CD140a, Pdgfr-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18595
HGNC: HGNC:8803
Homologene: 31361
Mt2
Name: metallothionein 2
Synonyms: MT-II, Mt-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17750
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Psmd5
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
Synonyms: S5b, 1500032A03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66998
HGNC: HGNC:9563
Homologene: 37999
Dmpk
Name: dystrophia myotonica-protein kinase
Synonyms: DM, Dm15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13400
HGNC: HGNC:2933
Homologene: 3247
Tecta
Name: tectorin alpha
Synonyms: [a]-tectorin, Tctna
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
Spocd1
Name: SPOC domain containing 1
Synonyms: OTTMUSG00000009522
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 622480
Homologene: 83439
Adgrb3
Name: adhesion G protein-coupled receptor B3
Synonyms: A830096D10Rik, Bai3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210933
HGNC: HGNC:945
Homologene: 1289
Rnf213
Name: ring finger protein 213
Synonyms: D11Ertd759e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 672511
Homologene: 45439
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: smMHC, SM2, SM1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Lmntd1
Name: lamin tail domain containing 1
Synonyms: Lmna-rs1, 4933403M22Rik, Ifltd1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74071
Homologene: 69453
Vmn2r3
Name: vomeronasal 2, receptor 3
Synonyms: EG637004
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 637004
Ugt2a3
Name: UDP glucuronosyltransferase 2 family, polypeptide A3
Synonyms: 2010321J07Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72094
Homologene: 55988
Abcc9
Name: ATP-binding cassette, sub-family C member 9
Synonyms: SUR2B, SUR2A, Sur2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20928
HGNC: HGNC:60
Homologene: 56521
Scd3
Name: stearoyl-coenzyme A desaturase 3
Synonyms: 4930513N16Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 30049
VEGA: 19
Homologene: 137370
4930407I10Rik
Name: RIKEN cDNA 4930407I10 gene
Synonyms: LOC328573
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328573
VEGA: 15
Homologene: 130065
Igsf10
Name: immunoglobulin superfamily, member 10
Synonyms: 6530405F15Rik, CMF608, Adlican2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242050
Homologene: 18712
Pign
Name: phosphatidylinositol glycan anchor biosynthesis, class N
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 27392
HGNC: HGNC:8967
Homologene: 6330
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243369
Homologene: 45453
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: mKIAA4095, AK220484
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381157
Homologene: 73393
Krt84
Name: keratin 84
Synonyms: HRb-1, Krt2-3, Krt2-16
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16680
VEGA: 15
HGNC: HGNC:6461
Homologene: 22473
Cttnbp2
Name: cortactin binding protein 2
Synonyms: ORF4, Cortbp2, 9130022E09Rik, 4732477G22Rik, 3010022N24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30785
Homologene: 14125
Unc5c
Name: unc-5 netrin receptor C
Synonyms: Unc5h3, B130051O18Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22253
Homologene: 2765
Itih4
Name: inter alpha-trypsin inhibitor, heavy chain 4
Synonyms: Itih-4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16427
HGNC: HGNC:6169
Homologene: 1670
Rbm20
Name: RNA binding motif protein 20
Synonyms: 2010003H22Rik, 1110018J23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73713
Homologene: 28386
Plekhg3
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 3
Synonyms: MGC40768
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 263406
VEGA: 12
Homologene: 77478
Klhl29
Name: kelch-like 29
Synonyms: A230106N14Rik, Kbtbd9
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 208439
VEGA: 12
Homologene: 66272
Itgb6
Name: integrin beta 6
Synonyms: 4831415H04Rik, 2210409C20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16420
HGNC: HGNC:6161
Homologene: 685
Mindy4
Name: MINDY lysine 48 deubiquitinase 4
Synonyms: LOC384387, C330043M08Rik, Fam188b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330323
Homologene: 49991
Birc7
Name: baculoviral IAP repeat-containing 7
Synonyms: ML-IAP, Livin, KIAP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329581
Homologene: 51405
Naprt
Name: nicotinate phosphoribosyltransferase
Synonyms: 9130210N20Rik, Naprt1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223646
VEGA: 15
Homologene: 82285
Fkbp10
Name: FK506 binding protein 10
Synonyms: FKBP65, Fkbp1-rs, Fkbp-rs1, Fkbp6, 65kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14230
Homologene: 7718
Zhx3
Name: zinc fingers and homeoboxes 3
Synonyms: 4932418O04Rik, 1810059C13Rik, 9530010N21Rik, Tix1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320799
Homologene: 9000
Klk1b5
Name: kallikrein 1-related peptidase b5
Synonyms: mGK-5, Klk5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16622
Homologene: 68141
Ccdc112
Name: coiled-coil domain containing 112
Synonyms: 8430438M01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240261
VEGA: 18
Homologene: 17617
Vmn1r83
Name: vomeronasal 1 receptor 83
Synonyms: V1rg8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171243
Homologene: 74330
Myct1
Name: myc target 1
Synonyms: Mtmc1, MT-MC1, 1110020B04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68632
VEGA: 10
Homologene: 11833
Zfand1
Name: zinc finger, AN1-type domain 1
Synonyms: 2310008M20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66361
Homologene: 6779
Cyp4v3
Name: cytochrome P450, family 4, subfamily v, polypeptide 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102294
Homologene: 133054
Sh2d4b
Name: SH2 domain containing 4B
Synonyms: A430109M18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328381
Homologene: 19164
1700025G04Rik
Name: RIKEN cDNA 1700025G04 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69399
Homologene: 12776
Jakmip3
Name: janus kinase and microtubule interacting protein 3
Synonyms: 6330417G02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74004
Homologene: 90425
BC061237
Name: cDNA sequence BC061237
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 385138
Homologene: 128452
Gnptg
Name: N-acetylglucosamine-1-phosphotransferase, gamma subunit
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 214505
VEGA: 17
Homologene: 13047
1700066M21Rik
Name: RIKEN cDNA 1700066M21 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73467
Homologene: 13624
Or8b49
Name: olfactory receptor family 8 subfamily B member 49
Synonyms: GA_x6K02T2PVTD-32296575-32297513, MOR165-9P, MOR165-10, Olfr913
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258225
VEGA: 9
Homologene: 79398
Igkv9-129
Name: immunoglobulin kappa variable 9-129
Synonyms: immunoglobulin kappa light chain
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 692182
Tcf24
Name: transcription factor 24
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100039596
Homologene: 100093
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 9,967,163 bp
  • A to G, chromosome 1 at 25,111,847 bp
  • T to A, chromosome 1 at 57,382,849 bp
  • C to T, chromosome 1 at 105,585,054 bp
  • T to A, chromosome 1 at 152,006,598 bp
  • A to G, chromosome 2 at 34,857,743 bp
  • A to T, chromosome 2 at 60,627,980 bp
  • C to A, chromosome 2 at 80,508,711 bp
  • T to C, chromosome 2 at 94,375,128 bp
  • G to T, chromosome 2 at 130,275,982 bp
  • T to C, chromosome 2 at 160,781,296 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • A to T, chromosome 2 at 180,932,993 bp
  • T to C, chromosome 3 at 10,344,802 bp
  • T to C, chromosome 3 at 27,145,977 bp
  • T to C, chromosome 3 at 56,058,727 bp
  • T to A, chromosome 3 at 59,329,989 bp
  • T to A, chromosome 3 at 64,287,471 bp
  • C to G, chromosome 3 at 141,803,820 bp
  • T to A, chromosome 4 at 129,951,838 bp
  • A to T, chromosome 4 at 155,159,559 bp
  • T to C, chromosome 5 at 75,183,073 bp
  • T to C, chromosome 5 at 87,336,499 bp
  • T to C, chromosome 5 at 143,714,959 bp
  • T to C, chromosome 6 at 18,414,299 bp
  • A to G, chromosome 6 at 48,481,267 bp
  • T to C, chromosome 6 at 55,278,238 bp
  • T to A, chromosome 6 at 67,840,237 bp
  • C to T, chromosome 6 at 119,913,080 bp
  • T to C, chromosome 6 at 142,600,694 bp
  • T to C, chromosome 6 at 145,417,426 bp
  • A to C, chromosome 7 at 12,321,916 bp
  • C to A, chromosome 7 at 19,091,961 bp
  • T to A, chromosome 7 at 44,219,768 bp
  • A to T, chromosome 7 at 126,787,294 bp
  • G to A, chromosome 7 at 139,007,442 bp
  • G to T, chromosome 7 at 140,004,969 bp
  • A to G, chromosome 8 at 3,625,208 bp
  • A to T, chromosome 8 at 45,321,748 bp
  • A to T, chromosome 8 at 94,172,848 bp
  • G to A, chromosome 8 at 120,570,731 bp
  • C to A, chromosome 9 at 31,097,124 bp
  • T to C, chromosome 9 at 37,417,472 bp
  • T to G, chromosome 9 at 38,595,150 bp
  • T to C, chromosome 9 at 42,367,063 bp
  • C to T, chromosome 10 at 5,604,208 bp
  • A to T, chromosome 10 at 27,369,161 bp
  • A to T, chromosome 10 at 61,686,393 bp
  • C to T, chromosome 10 at 102,485,007 bp
  • A to T, chromosome 11 at 66,053,014 bp
  • A to G, chromosome 11 at 100,422,036 bp
  • A to G, chromosome 11 at 119,288,879 bp
  • A to G, chromosome 11 at 119,473,438 bp
  • A to T, chromosome 12 at 5,137,542 bp
  • C to A, chromosome 12 at 76,564,974 bp
  • G to A, chromosome 12 at 102,584,345 bp
  • C to T, chromosome 14 at 30,895,525 bp
  • T to C, chromosome 14 at 40,873,989 bp
  • A to C, chromosome 14 at 44,504,234 bp
  • T to C, chromosome 15 at 75,893,584 bp
  • G to T, chromosome 15 at 82,065,850 bp
  • A to G, chromosome 15 at 101,528,786 bp
  • A to G, chromosome 16 at 14,234,414 bp
  • C to T, chromosome 16 at 44,499,443 bp
  • T to A, chromosome 16 at 91,695,300 bp
  • T to C, chromosome 17 at 25,234,654 bp
  • G to A, chromosome 17 at 27,118,677 bp
  • T to C, chromosome 17 at 34,037,454 bp
  • A to T, chromosome 18 at 10,553,843 bp
  • C to T, chromosome 18 at 46,311,759 bp
  • A to G, chromosome 19 at 44,241,837 bp
  • A to T, chromosome 19 at 53,813,336 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8886 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068691-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.