Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8888Btlr/Mmmh
Stock Number:
068692-MU
Citation ID:
RRID:MMRRC_068692-MU
Other Names:
R8888 (G1)
Major Collection:

Strain Information

Cdh1
Name: cadherin 1
Synonyms: E-cadherin, Ecad, UM, uvomorulin, L-CAM, E-cad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12550
HGNC: HGNC:1748
Homologene: 20917
Ext1
Name: exostosin glycosyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14042
HGNC: HGNC:3512
Homologene: 30957
Lamb1
Name: laminin B1
Synonyms: Lamb-1, C81607, C80098, D130003D08Rik, Lamb1-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16777
HGNC: HGNC:6486
Homologene: 1722
Col3a1
Name: collagen, type III, alpha 1
Synonyms: Col3a-1, Tsk-2, Tsk2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12825
HGNC: HGNC:2201
Homologene: 55433
Htr2a
Name: 5-hydroxytryptamine (serotonin) receptor 2A
Synonyms: 5-HT2A receptor, Htr-2, Htr2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 15558
VEGA: 14
HGNC: HGNC:5293
Homologene: 68073
Mrpl35
Name: mitochondrial ribosomal protein L35
Synonyms: 1110066C01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66223
Homologene: 9598
Dock5
Name: dedicator of cytokinesis 5
Synonyms: lr2, 1110060D06Rik, rlc
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68813
VEGA: 14
Homologene: 57016
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 8,677,850 bp
  • G to A, chromosome 1 at 45,339,979 bp
  • T to A, chromosome 1 at 83,209,290 bp
  • A to G, chromosome 1 at 192,897,558 bp
  • A to C, chromosome 2 at 14,307,949 bp
  • A to T, chromosome 2 at 15,845,227 bp
  • A to T, chromosome 2 at 35,000,849 bp
  • A to T, chromosome 2 at 76,833,306 bp
  • T to C, chromosome 2 at 87,418,315 bp
  • T to C, chromosome 2 at 94,326,704 bp
  • G to A, chromosome 2 at 112,156,629 bp
  • T to C, chromosome 2 at 152,882,335 bp
  • A to T, chromosome 3 at 100,962,712 bp
  • G to A, chromosome 3 at 108,413,564 bp
  • A to G, chromosome 4 at 43,304,687 bp
  • C to T, chromosome 4 at 98,765,510 bp
  • C to A, chromosome 4 at 109,073,136 bp
  • A to G, chromosome 4 at 116,641,063 bp
  • C to G, chromosome 4 at 124,658,359 bp
  • T to C, chromosome 4 at 130,211,430 bp
  • T to C, chromosome 5 at 24,550,630 bp
  • C to T, chromosome 5 at 30,745,343 bp
  • T to C, chromosome 5 at 63,805,898 bp
  • GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG to GCGCGAGGCCGAGAGGCAGG, chromosome 5 at 76,856,954 bp
  • T to G, chromosome 5 at 143,225,663 bp
  • C to T, chromosome 6 at 22,016,963 bp
  • C to T, chromosome 6 at 71,816,287 bp
  • C to T, chromosome 6 at 119,913,080 bp
  • A to T, chromosome 6 at 139,730,366 bp
  • T to A, chromosome 7 at 28,886,524 bp
  • C to T, chromosome 7 at 101,840,201 bp
  • T to A, chromosome 7 at 104,107,095 bp
  • T to C, chromosome 7 at 111,779,502 bp
  • C to T, chromosome 7 at 140,261,619 bp
  • T to C, chromosome 7 at 140,969,586 bp
  • C to T, chromosome 8 at 22,090,479 bp
  • G to A, chromosome 8 at 94,525,490 bp
  • T to C, chromosome 8 at 104,125,460 bp
  • CT to C, chromosome 8 at 104,182,032 bp
  • T to A, chromosome 8 at 106,604,339 bp
  • T to C, chromosome 8 at 122,894,275 bp
  • A to G, chromosome 9 at 4,664,951 bp
  • G to T, chromosome 9 at 44,075,597 bp
  • A to G, chromosome 9 at 86,521,534 bp
  • A to T, chromosome 9 at 101,023,252 bp
  • T to A, chromosome 9 at 113,903,868 bp
  • A to T, chromosome 10 at 53,348,815 bp
  • A to T, chromosome 10 at 62,659,607 bp
  • G to T, chromosome 10 at 75,639,618 bp
  • A to T, chromosome 10 at 127,888,561 bp
  • T to A, chromosome 11 at 20,001,019 bp
  • A to G, chromosome 11 at 98,390,776 bp
  • T to A, chromosome 11 at 103,618,830 bp
  • A to T, chromosome 12 at 5,137,542 bp
  • A to G, chromosome 12 at 31,302,954 bp
  • A to T, chromosome 12 at 36,123,983 bp
  • C to A, chromosome 12 at 70,893,872 bp
  • C to T, chromosome 13 at 20,564,460 bp
  • T to C, chromosome 13 at 100,189,136 bp
  • T to C, chromosome 13 at 119,430,265 bp
  • T to A, chromosome 14 at 54,369,836 bp
  • T to A, chromosome 14 at 66,174,793 bp
  • A to G, chromosome 14 at 67,817,663 bp
  • T to C, chromosome 14 at 70,612,704 bp
  • C to T, chromosome 14 at 74,645,177 bp
  • T to C, chromosome 15 at 53,092,327 bp
  • G to T, chromosome 15 at 97,245,508 bp
  • A to G, chromosome 16 at 18,623,111 bp
  • A to T, chromosome 16 at 75,555,822 bp
  • G to A, chromosome 17 at 27,118,677 bp
  • T to C, chromosome 17 at 66,031,573 bp
  • G to A, chromosome 17 at 74,528,538 bp
  • C to A, chromosome 18 at 15,833,150 bp
  • T to G, chromosome 18 at 20,590,069 bp
  • A to G, chromosome 18 at 58,582,234 bp
  • C to A, chromosome 18 at 78,012,871 bp
  • T to A, chromosome 19 at 38,810,307 bp
  • T to C, chromosome 19 at 39,881,466 bp
  • T to A, chromosome 19 at 45,796,661 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8888 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068692-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.