Strain Name:
C57BL/6J-MtgxR8888Btlr/Mmmh
Stock Number:
068692-MU
Citation ID:
RRID:MMRRC_068692-MU
Other Names:
R8888 (G1)
Major Collection:

Strain Information

Cdh1
Name: cadherin 1
Synonyms: uvomorulin, L-CAM, E-cadherin, UM, E-cad, Ecad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12550
HGNC: HGNC:1748
Homologene: 20917
Ext1
Name: exostosin glycosyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14042
HGNC: HGNC:3512
Homologene: 30957
Lamb1
Name: laminin B1
Synonyms: Lamb-1, D130003D08Rik, C80098, Lamb1-1, C81607
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16777
HGNC: HGNC:6486
Homologene: 1722
Col3a1
Name: collagen, type III, alpha 1
Synonyms: Tsk2, Col3a-1, Tsk-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12825
HGNC: HGNC:2201
Homologene: 55433
Htr2a
Name: 5-hydroxytryptamine (serotonin) receptor 2A
Synonyms: Htr2, Htr-2, 5-HT2A receptor
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 15558
VEGA: 14
HGNC: HGNC:5293
Homologene: 68073
Mrpl35
Name: mitochondrial ribosomal protein L35
Synonyms: 1110066C01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66223
Homologene: 9598
Dock5
Name: dedicator of cytokinesis 5
Synonyms: rlc, lr2, 1110060D06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68813
VEGA: 14
Homologene: 57016
Dmtn
Name: dematin actin binding protein
Synonyms: dematin, Epb4.9
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13829
VEGA: 14
HGNC: HGNC:3382
Homologene: 1496
Gria4
Name: glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms: Gluralpha4, Glur-4, Glur4, spkw1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14802
HGNC: HGNC:4574
Homologene: 20227
Slc7a7
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 7
Synonyms: my+lat1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20540
Homologene: 88701
Paip1
Name: polyadenylate binding protein-interacting protein 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218693
Homologene: 4709
Ankrd12
Name: ankyrin repeat domain 12
Synonyms: 2900001A12Rik, ANCO-2, GAC-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106585
Homologene: 9059
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: D630005A10Rik, apollon, A430032G04Rik, A430040A19Rik, Bruce
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Tpx2
Name: TPX2, microtubule-associated
Synonyms: 2610005B21Rik, REPP86, p100, DIL2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72119
HGNC: HGNC:1249
Homologene: 8107
Ttc17
Name: tetratricopeptide repeat domain 17
Synonyms: 9130020K17Rik, D2Bwg1005e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74569
Homologene: 10100
Ankrd11
Name: ankyrin repeat domain 11
Synonyms: 9530048I21Rik, 3010027A04Rik, 2410104C19Rik, Yod
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 77087
Homologene: 69134
Spred2
Name: sprouty-related EVH1 domain containing 2
Synonyms: Spred-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 114716
Homologene: 24918
Bzw2
Name: basic leucine zipper and W2 domains 2
Synonyms: HSPC028, 1110001I24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66912
VEGA: 12
Homologene: 8530
Clasp2
Name: CLIP associating protein 2
Synonyms: CLASP2alpha, 8030404L10Rik, CLASP2, CLASP2gamma, 1500004F14Rik, CLASP2beta
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76499
VEGA: 9
Homologene: 24944
Dop1a
Name: DOP1 leucine zipper like protein A
Synonyms: Dopey1, B130005I07Rik, D9Ertd809e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320615
Homologene: 26645
Kcnip2
Name: Kv channel-interacting protein 2
Synonyms: KChIP2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 80906
Homologene: 23710
Syt14
Name: synaptotagmin XIV
Synonyms: B230320I09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329324
Homologene: 17719
Epg5
Name: ectopic P-granules 5 autophagy tethering factor
Synonyms: 5430411K18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100502841
VEGA: 18
Homologene: 14575
Osbpl9
Name: oxysterol binding protein-like 9
Synonyms: 2600011I06Rik, ORP-9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100273
Homologene: 69380
Ifitm1
Name: interferon induced transmembrane protein 1
Synonyms: fragilis2, 1110036C17Rik, Mil2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68713
HGNC: HGNC:5412
Homologene: 135938
Kank4
Name: KN motif and ankyrin repeat domains 4
Synonyms: Ankrd38
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242553
Homologene: 18244
Rad52
Name: RAD52 homolog, DNA repair protein
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19365
HGNC: HGNC:9824
Homologene: 31118
Dsg2
Name: desmoglein 2
Synonyms: D18Ertd293e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13511
HGNC: HGNC:3049
Homologene: 1464
Ttf2
Name: transcription termination factor, RNA polymerase II
Synonyms: 4632434F22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74044
Homologene: 37826
Akr1a1
Name: aldo-keto reductase family 1, member A1
Synonyms: Akr1a4, 2610201A18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 58810
HGNC: HGNC:380
Homologene: 74565
Noc3l
Name: NOC3 like DNA replication regulator
Synonyms: Fad24
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 57753
VEGA: 19
Homologene: 39642
Frmd6
Name: FERM domain containing 6
Synonyms: 2610019M19Rik, 4930488L10Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319710
VEGA: 12
Homologene: 12449
Pgap3
Name: post-GPI attachment to proteins 3
Synonyms: CAB2, D430035D22Rik, Perld1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320655
Homologene: 5484
Amigo2
Name: adhesion molecule with Ig like domain 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105827
VEGA: 15
Homologene: 18649
Itpr3
Name: inositol 1,4,5-triphosphate receptor 3
Synonyms: Ip3r3, Itpr-3, tf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16440
HGNC: HGNC:6182
Homologene: 1675
Susd2
Name: sushi domain containing 2
Synonyms: 1200011D11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71733
VEGA: 10
Homologene: 10481
Septin5
Name: septin 5
Synonyms: Cdcrel1, Sept5, Pnutl1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 18951
VEGA: 16
HGNC: HGNC:9164
Homologene: 74446
Usp2
Name: ubiquitin specific peptidase 2
Synonyms: B930035K21Rik, ubp41
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 53376
Homologene: 3098
Ttn
Name: titin
Synonyms: connectin, shru, D330041I19Rik, 2310057K23Rik, mdm, D830007G01Rik, 2310074I15Rik, 1100001C23Rik, 2310036G12Rik, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pik3c2g
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18705
HGNC: HGNC:8973
Homologene: 3362
Mrc1
Name: mannose receptor, C type 1
Synonyms: CD206, MR
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17533
HGNC: HGNC:7228
Homologene: 37622
Celsr2
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: flamingo, mfmi1, EGFL2, Adgrc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53883
HGNC: HGNC:3231
Homologene: 1078
Or4f62
Name: olfactory receptor family 4 subfamily F member 62
Synonyms: GA_x6K02T2Q125-73202172-73203134, Olfr1318, MOR245-16
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258022
Homologene: 134079
Naip2
Name: NLR family, apoptosis inhibitory protein 2
Synonyms: Birc1b, Naip2, Naip-rs6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17948
HGNC: HGNC:7634
Homologene: 136092
Sntg1
Name: syntrophin, gamma 1
Synonyms: SYN4, G1SYN
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71096
Homologene: 56834
Galnt18
Name: polypeptide N-acetylgalactosaminyltransferase 18
Synonyms: Galntl4, 2900011G21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233733
Homologene: 18347
Cdh5
Name: cadherin 5
Synonyms: CD144, VECD, VEC, 7B4/cadherin-5, VE-cadherin, VEcad, VE-Cad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12562
HGNC: HGNC:1764
Homologene: 1359
Scart2
Name: scavenger receptor family member expressed on T cells 2
Synonyms: 5830411N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244234
Homologene: 133218
Hc
Name: hemolytic complement
Synonyms: C5, C5a, Hfib2, He
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15139
HGNC: HGNC:1331
Homologene: 20412
Capn12
Name: calpain 12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 60594
Homologene: 77333
Nlrc5
Name: NLR family, CARD domain containing 5
Synonyms: AI451557
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 434341
Homologene: 88935
Lrrc37
Name: leucine rich repeat containing 37
Synonyms: Gm884, LOC380730
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380730
Homologene: 134511
Gm10036
Name: predicted gene 10036
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100040551
VEGA: 18
Cped1
Name: cadherin-like and PC-esterase domain containing 1
Synonyms: A430107O13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214642
Homologene: 57014
Daw1
Name: dynein assembly factor with WDR repeat domains 1
Synonyms: b2b1116Clo, b2b1584Clo, Wdr69, 4930563E19Rik, 4933429D11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71227
Slc27a6
Name: solute carrier family 27 (fatty acid transporter), member 6
Synonyms: FATP6, 4732438L20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225579
Homologene: 38385
Cep85l
Name: centrosomal protein 85-like
Synonyms: Gm9766
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100038725
VEGA: 10
Homologene: 52598
Or52d1
Name: olfactory receptor family 52 subfamily D member 1
Synonyms: GA_x6K02T2PBJ9-6841330-6842268, Olfr646, MOR33-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259058
Homologene: 17481
Nwd2
Name: NACHT and WD repeat domain containing 2
Synonyms: 3110047P20Rik, B830017A01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319807
Homologene: 14974
Atp8b5
Name: ATPase, class I, type 8B, member 5
Synonyms: 4930417M19Rik, FetA
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320571
Homologene: 99882
Spdye4a
Name: speedy/RINGO cell cycle regulator family, member E4A
Synonyms: 4930445A17Rik, speedy B, speedy/ringo, 4930451F05Rik, Spdyb
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74673
Homologene: 134531
Bean1
Name: brain expressed, associated with Nedd4, 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 65115
Homologene: 110172
Ptk2b
Name: PTK2 protein tyrosine kinase 2 beta
Synonyms: Raftk, related adhesion focal tyrosine kinase, cellular adhesion kinase beta, E430023O05Rik, PYK2, proline-rich tyrosine kinase 2, CAKbeta, calcium-dependent tyrosine kinase
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19229
HGNC: HGNC:9612
Homologene: 23001
Rdh7
Name: retinol dehydrogenase 7
Synonyms: CRAD2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54150
Homologene: 137324
Iqca1l
Name: IQ motif containing with AAA domain 1 like
Synonyms: 4931409K22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231045
Homologene: 18602
Klhl29
Name: kelch-like 29
Synonyms: Kbtbd9, A230106N14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 208439
VEGA: 12
Homologene: 66272
Elmo1
Name: engulfment and cell motility 1
Synonyms: C230095H21Rik, 6330578D22Rik, CED-12
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 140580
Homologene: 56685
Pou3f1
Name: POU domain, class 3, transcription factor 1
Synonyms: Tst1, Oct6, Test1, Tst-1, Otf6, Scip, Oct-6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18991
HGNC: HGNC:9214
Homologene: 20590
Pccb
Name: propionyl Coenzyme A carboxylase, beta polypeptide
Synonyms: 1300012P06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66904
HGNC: HGNC:8654
Homologene: 447
Dpysl5
Name: dihydropyrimidinase-like 5
Synonyms: Crmp5, CRMP-5, CRAM
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 65254
Homologene: 41347
Nek5
Name: NIMA (never in mitosis gene a)-related expressed kinase 5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330721
HGNC: HGNC:7748
Homologene: 87952
Cyp2c69
Name: cytochrome P450, family 2, subfamily c, polypeptide 69
Synonyms: AI098658
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 100043108
VEGA: 19
Homologene: 74936
Or10ag2
Name: olfactory receptor family 10 subfamily AG member 2
Synonyms: MOR264-17, GA_x6K02T2Q125-48917235-48918206, Olfr1123
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258347
Homologene: 105187
Ldc1
Name: leucine decarboxylase 1
Synonyms: Gm853, LOC332942
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 332942
Homologene: 128653
Cracd
Name: capping protein inhibiting regulator of actin
Synonyms: C530008M17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320827
Homologene: 136278
Stox1
Name: storkhead box 1
Synonyms: 4732470K04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216021
Homologene: 17649
Lipi
Name: lipase, member I
Synonyms: lpd1, D930038D03Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 320355
Homologene: 77864
Folr2
Name: folate receptor beta
Synonyms: Folbp-2, FBP2, Folbp2, Folbp2, FR-P3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14276
Homologene: 627
Malrd1
Name: MAM and LDL receptor class A domain containing 1
Synonyms: Diet1, Gm13364, Gm13318
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 102635496
Homologene: 136214
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 8,677,850 bp
  • G to A, chromosome 1 at 45,339,979 bp
  • T to A, chromosome 1 at 83,209,290 bp
  • A to G, chromosome 1 at 192,897,558 bp
  • A to C, chromosome 2 at 14,307,949 bp
  • A to T, chromosome 2 at 15,845,227 bp
  • A to T, chromosome 2 at 35,000,849 bp
  • A to T, chromosome 2 at 76,833,306 bp
  • T to C, chromosome 2 at 87,418,315 bp
  • T to C, chromosome 2 at 94,326,704 bp
  • G to A, chromosome 2 at 112,156,629 bp
  • T to C, chromosome 2 at 152,882,335 bp
  • A to T, chromosome 3 at 100,962,712 bp
  • G to A, chromosome 3 at 108,413,564 bp
  • A to G, chromosome 4 at 43,304,687 bp
  • C to T, chromosome 4 at 98,765,510 bp
  • C to A, chromosome 4 at 109,073,136 bp
  • A to G, chromosome 4 at 116,641,063 bp
  • C to G, chromosome 4 at 124,658,359 bp
  • T to C, chromosome 4 at 130,211,430 bp
  • T to C, chromosome 5 at 24,550,630 bp
  • C to T, chromosome 5 at 30,745,343 bp
  • T to C, chromosome 5 at 63,805,898 bp
  • GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG to GCGCGAGGCCGAGAGGCAGG, chromosome 5 at 76,856,954 bp
  • T to G, chromosome 5 at 143,225,663 bp
  • C to T, chromosome 6 at 22,016,963 bp
  • C to T, chromosome 6 at 71,816,287 bp
  • C to T, chromosome 6 at 119,913,080 bp
  • A to T, chromosome 6 at 139,730,366 bp
  • T to A, chromosome 7 at 28,886,524 bp
  • C to T, chromosome 7 at 101,840,201 bp
  • T to A, chromosome 7 at 104,107,095 bp
  • T to C, chromosome 7 at 111,779,502 bp
  • C to T, chromosome 7 at 140,261,619 bp
  • T to C, chromosome 7 at 140,969,586 bp
  • C to T, chromosome 8 at 22,090,479 bp
  • G to A, chromosome 8 at 94,525,490 bp
  • T to C, chromosome 8 at 104,125,460 bp
  • CT to C, chromosome 8 at 104,182,032 bp
  • T to A, chromosome 8 at 106,604,339 bp
  • T to C, chromosome 8 at 122,894,275 bp
  • A to G, chromosome 9 at 4,664,951 bp
  • G to T, chromosome 9 at 44,075,597 bp
  • A to G, chromosome 9 at 86,521,534 bp
  • A to T, chromosome 9 at 101,023,252 bp
  • T to A, chromosome 9 at 113,903,868 bp
  • A to T, chromosome 10 at 53,348,815 bp
  • A to T, chromosome 10 at 62,659,607 bp
  • G to T, chromosome 10 at 75,639,618 bp
  • A to T, chromosome 10 at 127,888,561 bp
  • T to A, chromosome 11 at 20,001,019 bp
  • A to G, chromosome 11 at 98,390,776 bp
  • T to A, chromosome 11 at 103,618,830 bp
  • A to T, chromosome 12 at 5,137,542 bp
  • A to G, chromosome 12 at 31,302,954 bp
  • A to T, chromosome 12 at 36,123,983 bp
  • C to A, chromosome 12 at 70,893,872 bp
  • C to T, chromosome 13 at 20,564,460 bp
  • T to C, chromosome 13 at 100,189,136 bp
  • T to C, chromosome 13 at 119,430,265 bp
  • T to A, chromosome 14 at 54,369,836 bp
  • T to A, chromosome 14 at 66,174,793 bp
  • A to G, chromosome 14 at 67,817,663 bp
  • T to C, chromosome 14 at 70,612,704 bp
  • C to T, chromosome 14 at 74,645,177 bp
  • T to C, chromosome 15 at 53,092,327 bp
  • G to T, chromosome 15 at 97,245,508 bp
  • A to G, chromosome 16 at 18,623,111 bp
  • A to T, chromosome 16 at 75,555,822 bp
  • G to A, chromosome 17 at 27,118,677 bp
  • T to C, chromosome 17 at 66,031,573 bp
  • G to A, chromosome 17 at 74,528,538 bp
  • C to A, chromosome 18 at 15,833,150 bp
  • T to G, chromosome 18 at 20,590,069 bp
  • A to G, chromosome 18 at 58,582,234 bp
  • C to A, chromosome 18 at 78,012,871 bp
  • T to A, chromosome 19 at 38,810,307 bp
  • T to C, chromosome 19 at 39,881,466 bp
  • T to A, chromosome 19 at 45,796,661 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8888 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068692-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.