Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8915Btlr/Mmmh
Stock Number:
068703-MU
Citation ID:
RRID:MMRRC_068703-MU
Other Names:
R8915 (G1)
Major Collection:

Strain Information

Rnd1
Name: Rho family GTPase 1
Synonyms: Arhs, A830014L09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223881
Homologene: 8706
Ppp4r1
Name: protein phosphatase 4, regulatory subunit 1
Synonyms: Pp4r1, 3110001J10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70351
HGNC: HGNC:9320
Homologene: 81737
Carmil1
Name: capping protein regulator and myosin 1 linker 1
Synonyms: 1110037D04Rik, Lrrc16, Carmil, Lrrc16a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68732
Homologene: 9757
Trip13
Name: thyroid hormone receptor interactor 13
Synonyms: 2410002G23Rik, D13Ertd328e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69716
Homologene: 3125
Tpp2
Name: tripeptidyl peptidase II
Synonyms: TppII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22019
Homologene: 2471
Fto
Name: FTO alpha-ketoglutarate dependent dioxygenase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26383
Homologene: 8053
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 36,829,577 bp
  • T to C, chromosome 1 at 43,977,255 bp
  • C to A, chromosome 1 at 89,152,342 bp
  • C to T, chromosome 1 at 192,594,895 bp
  • T to A, chromosome 2 at 73,318,292 bp
  • T to A, chromosome 2 at 80,317,457 bp
  • T to C, chromosome 2 at 121,019,506 bp
  • T to C, chromosome 2 at 165,013,007 bp
  • T to C, chromosome 3 at 146,463,969 bp
  • G to A, chromosome 3 at 152,766,461 bp
  • G to T, chromosome 4 at 136,632,932 bp
  • T to C, chromosome 5 at 103,992,936 bp
  • T to C, chromosome 5 at 120,738,384 bp
  • A to G, chromosome 6 at 81,941,366 bp
  • A to G, chromosome 6 at 84,179,754 bp
  • T to C, chromosome 6 at 129,405,249 bp
  • A to G, chromosome 7 at 8,367,651 bp
  • A to T, chromosome 7 at 20,811,246 bp
  • T to C, chromosome 7 at 25,081,344 bp
  • T to A, chromosome 7 at 44,254,327 bp
  • TCCCAGG to T, chromosome 7 at 80,098,331 bp
  • C to T, chromosome 7 at 103,155,204 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • T to C, chromosome 8 at 91,409,843 bp
  • A to G, chromosome 8 at 126,953,158 bp
  • T to C, chromosome 9 at 66,411,174 bp
  • G to A, chromosome 9 at 105,396,681 bp
  • C to T, chromosome 9 at 119,774,297 bp
  • T to C, chromosome 10 at 34,092,419 bp
  • C to T, chromosome 10 at 52,101,709 bp
  • A to C, chromosome 11 at 95,021,201 bp
  • T to C, chromosome 12 at 40,073,433 bp
  • A to G, chromosome 12 at 104,315,050 bp
  • A to G, chromosome 13 at 24,141,726 bp
  • G to T, chromosome 13 at 54,726,371 bp
  • T to C, chromosome 13 at 73,932,966 bp
  • C to T, chromosome 13 at 81,567,439 bp
  • T to A, chromosome 13 at 119,712,338 bp
  • T to A, chromosome 14 at 46,384,445 bp
  • T to C, chromosome 14 at 54,639,155 bp
  • C to T, chromosome 15 at 56,668,489 bp
  • A to G, chromosome 15 at 98,677,300 bp
  • A to T, chromosome 17 at 22,339,526 bp
  • A to G, chromosome 17 at 45,560,141 bp
  • T to C, chromosome 17 at 65,829,381 bp
  • T to A, chromosome 18 at 22,524,706 bp
  • T to C, chromosome 18 at 80,117,742 bp
  • T to C, chromosome 19 at 16,873,594 bp
  • A to T, chromosome 19 at 39,807,547 bp
  • A to G, chromosome 19 at 55,088,880 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8915 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068703-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.