Strain Name:
C57BL/6J-MtgxR8939Btlr/Mmmh
Stock Number:
068712-MU
Citation ID:
RRID:MMRRC_068712-MU
Other Names:
R8939 (G1)
Major Collection:

Strain Information

Chrna6
Name: cholinergic receptor, nicotinic, alpha polypeptide 6
Synonyms: Acra6, alpha6 nAChR
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11440
Homologene: 20888
Gria2
Name: glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms: GluR2, Glur-2, GluR-B, Glur2, GluA2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14800
HGNC: HGNC:4572
Homologene: 20225
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Ppp4r1
Name: protein phosphatase 4, regulatory subunit 1
Synonyms: 3110001J10Rik, Pp4r1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70351
HGNC: HGNC:9320
Homologene: 81737
Ddx4
Name: DEAD box helicase 4
Synonyms: VASA, Mvh, DEAD (Asp-Glu-Ala-Asp) box polypeptide 4, mvh / m'vasa
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13206
VEGA: 13
Homologene: 49227
Stim2
Name: stromal interaction molecule 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 116873
Homologene: 32490
Aff4
Name: AF4/FMR2 family, member 4
Synonyms: Alf4, Laf4l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 93736
Homologene: 8683
Sec23b
Name: SEC23 homolog B, COPII coat complex component
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27054
Homologene: 74571
Sgcb
Name: sarcoglycan, beta (dystrophin-associated glycoprotein)
Synonyms: beta-SG
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 24051
Homologene: 195
Map3k1
Name: mitogen-activated protein kinase kinase kinase 1
Synonyms: MEKK1, Mekk
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26401
HGNC: HGNC:6848
Homologene: 8056
Syt14
Name: synaptotagmin XIV
Synonyms: B230320I09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329324
Homologene: 17719
Angptl7
Name: angiopoietin-like 7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 654812
Homologene: 133923
Pnpla6
Name: patatin-like phospholipase domain containing 6
Synonyms: Swiss-cheese, MSws, Nte
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50767
Homologene: 21333
Pcnx3
Name: pecanex homolog 3
Synonyms: Pcnxl3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104401
Homologene: 17000
Magi3
Name: membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms: 6530407C02Rik, 4732496O19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99470
Homologene: 26431
Ubqln4
Name: ubiquilin 4
Synonyms: UBIN
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 94232
HGNC: HGNC:1237
Homologene: 41346
Igflr1
Name: IGF-like family receptor 1
Synonyms: Tmem149, F630003I17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101883
Homologene: 49779
Fign
Name: fidgetin
Synonyms: Fgn
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 60344
Homologene: 5813
Umod
Name: uromodulin
Synonyms: Tamm-Horsfall glycoprotein, uromucoid, Urehd1, urehr4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22242
Homologene: 2522
F7
Name: coagulation factor VII
Synonyms: FVII, Cf7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14068
HGNC: HGNC:3544
Homologene: 7710
Slurp1
Name: secreted Ly6/Plaur domain containing 1
Synonyms: 1110021N19Rik, ARS component B
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 57277
Homologene: 10710
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Ttn
Name: titin
Synonyms: connectin, 1100001C23Rik, D330041I19Rik, D830007G01Rik, 2310074I15Rik, 2310036G12Rik, mdm, 2310057K23Rik, shru, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Myo16
Name: myosin XVI
Synonyms: Nyap3, C230040D10Rik, BM140241
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244281
Homologene: 34710
Or5b122
Name: olfactory receptor family 5 subfamily B member 122
Synonyms: Olfr1484, MOR202-37, GA_x6K02T2RE5P-3917859-3918806
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258288
Homologene: 110492
Mgam
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232714
HGNC: HGNC:7043
Homologene: 130099
Xirp2
Name: xin actin-binding repeat containing 2
Synonyms: mXin beta, A530024P18Rik, 2310003D02Rik, Cmya3, myomaxin, 2310008C07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241431
Homologene: 19388
Abcc12
Name: ATP-binding cassette, sub-family C member 12
Synonyms: 4930467B22Rik, MRP9
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244562
Homologene: 57211
Acsm1
Name: acyl-CoA synthetase medium-chain family member 1
Synonyms: Macs, Bucs1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 117147
Homologene: 24930
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: sj, Cav1.1, fmd, muscle dysgenesis, DHPR alpha1s, Cchl1a3, mdg
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Zscan20
Name: zinc finger and SCAN domains 20
Synonyms: Zfp31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269585
Homologene: 51463
Sdr9c7
Name: 4short chain dehydrogenase/reductase family 9C, member 7
Synonyms: 1810054F20Rik, Rdhs, Sdro, Rdh20, SDR-O
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70061
Homologene: 23618
Abcc9
Name: ATP-binding cassette, sub-family C member 9
Synonyms: Sur2, SUR2A, SUR2B
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20928
HGNC: HGNC:60
Homologene: 56521
Qng1
Name: Q-nucleotide N-glycosylase 1
Synonyms: 2210016F16Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 70153
Homologene: 13005
Chl1
Name: cell adhesion molecule L1-like
Synonyms: CALL, close homolog of L1, LICAM2, A530023M13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12661
HGNC: HGNC:1939
Homologene: 21314
Slc25a48
Name: solute carrier family 25, member 48
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 328258
Homologene: 27065
Rhbdf1
Name: rhomboid 5 homolog 1
Synonyms: Dist1, Egfr-rs, Dist
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13650
Homologene: 32085
Il10ra
Name: interleukin 10 receptor, alpha
Synonyms: mIL-10R, Il10r, CDw210
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16154
HGNC: HGNC:5964
Homologene: 1196
Slc9a3
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 3
Synonyms: NHE3, 9030624O13Rik, NHE-3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105243
VEGA: 13
Homologene: 55804
Sh3pxd2b
Name: SH3 and PX domains 2B
Synonyms: Tks4, G431001E03Rik, Fad49
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268396
Homologene: 27952
Psd2
Name: pleckstrin and Sec7 domain containing 2
Synonyms: 6330404E20Rik, EFA6C
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74002
Homologene: 12522
Map3k6
Name: mitogen-activated protein kinase kinase kinase 6
Synonyms: MEKK6, MAPKKK6, Ask2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 53608
HGNC: HGNC:6858
Homologene: 3435
Rbak
Name: RB-associated KRAB zinc finger
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57782
Homologene: 23287
Rxfp1
Name: relaxin/insulin-like family peptide receptor 1
Synonyms: LOC381489, Lgr7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 381489
Homologene: 11007
Sqor
Name: sulfide quinone oxidoreductase
Synonyms: 0610039J17Rik, 4930557M22Rik, Sqrdl, flavo-binding protein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 59010
Homologene: 10921
Tmcc3
Name: transmembrane and coiled coil domains 3
Synonyms: A230066D03Rik, C630016B22Rik, LOC380656
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 319880
Homologene: 10792
Nr1i2
Name: nuclear receptor subfamily 1, group I, member 2
Synonyms: SXR, Pregnane X receptor, PXR.1, PXR.2, mPXR, PXR
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 18171
HGNC: HGNC:7968
Homologene: 40757
Or10h28
Name: olfactory receptor family 10 subfamily H member 28
Synonyms: Olfr63, MOR267-1, M4, GA_x6K02T2NTC5-9778-8828
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258939
Homologene: 130665
Clpx
Name: caseinolytic mitochondrial matrix peptidase chaperone subunit
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270166
HGNC: HGNC:2088
Homologene: 4851
Cfap45
Name: cilia and flagella associated protein 45
Synonyms: 1700028D05Rik, Ccdc19, Nesg1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71870
Homologene: 71837
Hsd3b1
Name: hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
Synonyms: D3Ertd383e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 15492
Homologene: 69149
4930578I06Rik
Name: RIKEN cDNA 4930578I06 gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67750
VEGA: 14
Homologene: 49859
Sstr4
Name: somatostatin receptor 4
Synonyms: Smstr4, sst4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20608
Homologene: 20286
Nlrx1
Name: NLR family member X1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270151
VEGA: 9
Homologene: 11623
Rusc1
Name: RUN and SH3 domain containing 1
Synonyms: 2210403N08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72296
Homologene: 75028
Klhdc1
Name: kelch domain containing 1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 271005
Homologene: 18155
Fam186b
Name: family with sequence similarity 186, member B
Synonyms: EG545136
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545136
VEGA: 15
Homologene: 69502
Stard13
Name: StAR related lipid transfer domain containing 13
Synonyms: GT650, DLC2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243362
Homologene: 64844
Grid1
Name: glutamate receptor, ionotropic, delta 1
Synonyms: GluRdelta1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14803
HGNC: HGNC:4575
Homologene: 69017
Adh6b
Name: alcohol dehydrogenase 6B (class V)
Synonyms: Adh5b
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100417514
HGNC: HGNC:255
Homologene: 139477
Vmn2r51
Name: vomeronasal 2, receptor 51
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042921
Homologene: 113703
Ugt2b34
Name: UDP glucuronosyltransferase 2 family, polypeptide B34
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100727
Homologene: 117389
Gsto2
Name: glutathione S-transferase omega 2
Synonyms: 4930425C18Rik, 1700020F09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68214
Homologene: 57057
Stard10
Name: StAR related lipid transfer domain containing 10
Synonyms: TISP-81, Pctpl, PC-TP2, Sdccag28, CGI-52, NY-C0-28, PCTP2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56018
Homologene: 4841
Fpr2
Name: formyl peptide receptor 2
Synonyms: Fpr-rs2, E330010I07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14289
HGNC: HGNC:3827
Homologene: 74395
Lce1h
Name: late cornified envelope 1H
Synonyms: Sprrl9, 2310066F03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67718
Mtx1
Name: metaxin 1
Synonyms: Gcap6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17827
HGNC: HGNC:7504
Homologene: 37623
Krtap4-6
Name: keratin associated protein 4-6
Synonyms: 1110054P19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68768
Homologene: 124486
Pcmtd2
Name: protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2
Synonyms: 5330414D10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 245867
Homologene: 10099
Bhlhe23
Name: basic helix-loop-helix family, member e23
Synonyms: A930001L02Rik, beta-cell E-box transactivating factor 4, Bhlhb4, BETA4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140489
Homologene: 50956
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 136,086,806 bp
  • C to G, chromosome 1 at 172,545,267 bp
  • G to A, chromosome 1 at 192,930,588 bp
  • T to A, chromosome 2 at 63,979,112 bp
  • A to C, chromosome 2 at 67,516,144 bp
  • T to C, chromosome 2 at 76,745,351 bp
  • C to T, chromosome 2 at 122,807,629 bp
  • T to C, chromosome 2 at 144,569,217 bp
  • C to A, chromosome 2 at 148,396,308 bp
  • T to A, chromosome 2 at 180,776,306 bp
  • T to C, chromosome 2 at 181,855,070 bp
  • T to C, chromosome 3 at 79,644,924 bp
  • A to T, chromosome 3 at 80,710,863 bp
  • A to G, chromosome 3 at 88,565,716 bp
  • T to A, chromosome 3 at 89,088,030 bp
  • A to G, chromosome 3 at 89,212,726 bp
  • A to T, chromosome 3 at 92,763,669 bp
  • A to G, chromosome 3 at 98,852,983 bp
  • T to C, chromosome 3 at 104,089,432 bp
  • T to C, chromosome 3 at 138,349,636 bp
  • A to G, chromosome 4 at 128,604,522 bp
  • T to A, chromosome 4 at 133,252,643 bp
  • T to C, chromosome 4 at 141,475,658 bp
  • G to A, chromosome 4 at 148,496,499 bp
  • G to T, chromosome 5 at 54,105,331 bp
  • A to T, chromosome 5 at 73,644,318 bp
  • A to G, chromosome 5 at 86,891,299 bp
  • C to T, chromosome 5 at 143,174,270 bp
  • A to T, chromosome 5 at 151,045,109 bp
  • G to A, chromosome 6 at 40,763,203 bp
  • A to G, chromosome 6 at 103,665,907 bp
  • T to C, chromosome 6 at 142,679,251 bp
  • C to A, chromosome 7 at 10,100,026 bp
  • CAGAG to CAG, chromosome 7 at 30,567,463 bp
  • A to G, chromosome 7 at 101,342,640 bp
  • T to C, chromosome 7 at 119,469,477 bp
  • A to T, chromosome 7 at 119,640,645 bp
  • A to T, chromosome 7 at 141,793,354 bp
  • GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG to GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG, chromosome 7 at 142,240,434 bp
  • A to G, chromosome 8 at 3,521,319 bp
  • T to C, chromosome 8 at 10,474,679 bp
  • G to T, chromosome 8 at 13,028,724 bp
  • T to A, chromosome 8 at 27,406,842 bp
  • A to G, chromosome 8 at 86,517,318 bp
  • A to G, chromosome 9 at 44,255,464 bp
  • A to G, chromosome 9 at 45,266,504 bp
  • A to G, chromosome 9 at 65,324,237 bp
  • A to T, chromosome 10 at 94,545,621 bp
  • A to G, chromosome 10 at 127,898,907 bp
  • G to A, chromosome 11 at 32,210,093 bp
  • T to C, chromosome 11 at 32,414,433 bp
  • A to T, chromosome 11 at 53,372,404 bp
  • A to G, chromosome 11 at 99,665,403 bp
  • C to T, chromosome 12 at 69,253,763 bp
  • C to T, chromosome 12 at 115,912,493 bp
  • C to T, chromosome 13 at 56,463,706 bp
  • C to T, chromosome 13 at 58,385,061 bp
  • C to A, chromosome 13 at 74,163,776 bp
  • G to T, chromosome 13 at 111,756,303 bp
  • A to T, chromosome 13 at 112,622,289 bp
  • G to A, chromosome 14 at 35,321,707 bp
  • A to G, chromosome 14 at 63,987,713 bp
  • G to A, chromosome 15 at 74,726,914 bp
  • T to C, chromosome 15 at 99,279,342 bp
  • C to T, chromosome 16 at 38,266,020 bp
  • T to C, chromosome 16 at 59,556,149 bp
  • T to C, chromosome 17 at 17,893,621 bp
  • A to G, chromosome 17 at 33,269,615 bp
  • T to C, chromosome 17 at 65,803,931 bp
  • G to A, chromosome 18 at 35,988,239 bp
  • A to G, chromosome 19 at 5,680,319 bp
  • A to C, chromosome 19 at 13,585,496 bp
  • T to C, chromosome 19 at 47,884,764 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8939 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068712-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.