Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8939Btlr/Mmmh
Stock Number:
068712-MU
Citation ID:
RRID:MMRRC_068712-MU
Other Names:
R8939 (G1)
Major Collection:

Strain Information

Chrna6
Name: cholinergic receptor, nicotinic, alpha polypeptide 6
Synonyms: Acra6, alpha6 nAChR
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11440
Homologene: 20888
Gria2
Name: glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms: GluR-B, GluR2, Glur-2, Glur2, GluA2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14800
HGNC: HGNC:4572
Homologene: 20225
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Ppp4r1
Name: protein phosphatase 4, regulatory subunit 1
Synonyms: Pp4r1, 3110001J10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70351
HGNC: HGNC:9320
Homologene: 81737
Ddx4
Name: DEAD box helicase 4
Synonyms: mvh / m'vasa, VASA, Mvh, DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13206
VEGA: 13
Homologene: 49227
Stim2
Name: stromal interaction molecule 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 116873
Homologene: 32490
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 136,086,806 bp
  • C to G, chromosome 1 at 172,545,267 bp
  • G to A, chromosome 1 at 192,930,588 bp
  • T to A, chromosome 2 at 63,979,112 bp
  • A to C, chromosome 2 at 67,516,144 bp
  • T to C, chromosome 2 at 76,745,351 bp
  • C to T, chromosome 2 at 122,807,629 bp
  • T to C, chromosome 2 at 144,569,217 bp
  • C to A, chromosome 2 at 148,396,308 bp
  • T to A, chromosome 2 at 180,776,306 bp
  • T to C, chromosome 2 at 181,855,070 bp
  • T to C, chromosome 3 at 79,644,924 bp
  • A to T, chromosome 3 at 80,710,863 bp
  • A to G, chromosome 3 at 88,565,716 bp
  • T to A, chromosome 3 at 89,088,030 bp
  • A to G, chromosome 3 at 89,212,726 bp
  • A to T, chromosome 3 at 92,763,669 bp
  • A to G, chromosome 3 at 98,852,983 bp
  • T to C, chromosome 3 at 104,089,432 bp
  • T to C, chromosome 3 at 138,349,636 bp
  • A to G, chromosome 4 at 128,604,522 bp
  • T to A, chromosome 4 at 133,252,643 bp
  • T to C, chromosome 4 at 141,475,658 bp
  • G to A, chromosome 4 at 148,496,499 bp
  • G to T, chromosome 5 at 54,105,331 bp
  • A to T, chromosome 5 at 73,644,318 bp
  • A to G, chromosome 5 at 86,891,299 bp
  • C to T, chromosome 5 at 143,174,270 bp
  • A to T, chromosome 5 at 151,045,109 bp
  • G to A, chromosome 6 at 40,763,203 bp
  • A to G, chromosome 6 at 103,665,907 bp
  • T to C, chromosome 6 at 142,679,251 bp
  • C to A, chromosome 7 at 10,100,026 bp
  • CAGAG to CAG, chromosome 7 at 30,567,463 bp
  • A to G, chromosome 7 at 101,342,640 bp
  • T to C, chromosome 7 at 119,469,477 bp
  • A to T, chromosome 7 at 119,640,645 bp
  • A to T, chromosome 7 at 141,793,354 bp
  • GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG to GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG, chromosome 7 at 142,240,434 bp
  • A to G, chromosome 8 at 3,521,319 bp
  • T to C, chromosome 8 at 10,474,679 bp
  • G to T, chromosome 8 at 13,028,724 bp
  • T to A, chromosome 8 at 27,406,842 bp
  • A to G, chromosome 8 at 86,517,318 bp
  • A to G, chromosome 9 at 44,255,464 bp
  • A to G, chromosome 9 at 45,266,504 bp
  • A to G, chromosome 9 at 65,324,237 bp
  • A to T, chromosome 10 at 94,545,621 bp
  • A to G, chromosome 10 at 127,898,907 bp
  • G to A, chromosome 11 at 32,210,093 bp
  • T to C, chromosome 11 at 32,414,433 bp
  • A to T, chromosome 11 at 53,372,404 bp
  • A to G, chromosome 11 at 99,665,403 bp
  • C to T, chromosome 12 at 69,253,763 bp
  • C to T, chromosome 12 at 115,912,493 bp
  • C to T, chromosome 13 at 56,463,706 bp
  • C to T, chromosome 13 at 58,385,061 bp
  • C to A, chromosome 13 at 74,163,776 bp
  • G to T, chromosome 13 at 111,756,303 bp
  • A to T, chromosome 13 at 112,622,289 bp
  • G to A, chromosome 14 at 35,321,707 bp
  • A to G, chromosome 14 at 63,987,713 bp
  • G to A, chromosome 15 at 74,726,914 bp
  • T to C, chromosome 15 at 99,279,342 bp
  • C to T, chromosome 16 at 38,266,020 bp
  • T to C, chromosome 16 at 59,556,149 bp
  • T to C, chromosome 17 at 17,893,621 bp
  • A to G, chromosome 17 at 33,269,615 bp
  • T to C, chromosome 17 at 65,803,931 bp
  • G to A, chromosome 18 at 35,988,239 bp
  • A to G, chromosome 19 at 5,680,319 bp
  • A to C, chromosome 19 at 13,585,496 bp
  • T to C, chromosome 19 at 47,884,764 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8939 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068712-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.