Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8785Btlr/Mmmh
Stock Number:
068722-MU
Citation ID:
RRID:MMRRC_068722-MU
Other Names:
R8785 (G1)
Major Collection:

Strain Information

Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Amigo1
Name: adhesion molecule with Ig like domain 1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229715
Homologene: 46421
Gldc
Name: glycine decarboxylase
Synonyms: D19Wsu57e, D030049L12Rik, b2b2679Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104174
VEGA: 19
HGNC: HGNC:4313
Homologene: 141
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Slit3
Name: slit guidance ligand 3
Synonyms: Slit1, b2b2362.1Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20564
Homologene: 2303
Cyp11b2
Name: cytochrome P450, family 11, subfamily b, polypeptide 2
Synonyms: aldosterone synthase, Cyp11b-2, Cyp11b, steroid-11-beta-hydroxylase
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13072
Homologene: 128035
Gria4
Name: glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms: Glur-4, Glur4, spkw1, Gluralpha4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14802
HGNC: HGNC:4574
Homologene: 20227
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 85,699,751 bp
  • T to C, chromosome 1 at 128,334,798 bp
  • T to A, chromosome 2 at 10,097,969 bp
  • T to C, chromosome 2 at 29,145,263 bp
  • T to A, chromosome 2 at 32,034,453 bp
  • T to G, chromosome 2 at 52,110,481 bp
  • A to G, chromosome 2 at 52,169,890 bp
  • T to C, chromosome 2 at 76,895,560 bp
  • T to C, chromosome 2 at 89,752,954 bp
  • C to T, chromosome 2 at 104,787,753 bp
  • A to G, chromosome 2 at 125,649,144 bp
  • T to C, chromosome 3 at 30,896,774 bp
  • T to C, chromosome 3 at 108,187,350 bp
  • G to A, chromosome 3 at 126,997,921 bp
  • T to A, chromosome 4 at 123,448,260 bp
  • A to T, chromosome 4 at 145,537,676 bp
  • A to T, chromosome 4 at 147,583,623 bp
  • G to A, chromosome 4 at 155,869,708 bp
  • A to G, chromosome 5 at 23,964,906 bp
  • A to T, chromosome 5 at 35,950,960 bp
  • C to T, chromosome 5 at 134,559,869 bp
  • G to A, chromosome 6 at 3,377,064 bp
  • C to T, chromosome 6 at 30,645,252 bp
  • A to T, chromosome 6 at 96,164,890 bp
  • A to T, chromosome 6 at 136,587,164 bp
  • G to A, chromosome 7 at 3,816,929 bp
  • T to A, chromosome 7 at 5,327,549 bp
  • C to A, chromosome 7 at 24,533,580 bp
  • C to T, chromosome 7 at 28,154,707 bp
  • T to A, chromosome 7 at 102,029,126 bp
  • A to T, chromosome 7 at 119,662,230 bp
  • A to T, chromosome 7 at 139,256,170 bp
  • A to T, chromosome 8 at 4,270,019 bp
  • C to T, chromosome 8 at 13,408,058 bp
  • A to T, chromosome 8 at 24,650,895 bp
  • A to C, chromosome 9 at 4,456,106 bp
  • A to G, chromosome 9 at 4,795,189 bp
  • A to T, chromosome 9 at 78,421,759 bp
  • T to A, chromosome 10 at 10,357,966 bp
  • T to A, chromosome 10 at 58,271,264 bp
  • T to A, chromosome 10 at 60,311,335 bp
  • GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC to GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC, chromosome 10 at 76,150,404 bp
  • ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT to ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT, chromosome 10 at 80,804,437 bp
  • C to T, chromosome 10 at 86,024,546 bp
  • A to G, chromosome 10 at 107,485,687 bp
  • A to T, chromosome 10 at 130,074,616 bp
  • A to G, chromosome 11 at 35,670,141 bp
  • C to A, chromosome 11 at 69,778,163 bp
  • A to G, chromosome 11 at 82,741,331 bp
  • G to A, chromosome 11 at 89,013,514 bp
  • C to A, chromosome 11 at 94,650,621 bp
  • C to G, chromosome 11 at 101,981,734 bp
  • G to A, chromosome 11 at 103,456,416 bp
  • T to C, chromosome 12 at 87,224,166 bp
  • C to A, chromosome 13 at 12,277,431 bp
  • T to C, chromosome 14 at 24,452,315 bp
  • T to A, chromosome 14 at 54,436,775 bp
  • T to C, chromosome 15 at 8,174,760 bp
  • T to A, chromosome 15 at 41,866,260 bp
  • G to A, chromosome 15 at 48,314,086 bp
  • C to T, chromosome 15 at 74,852,112 bp
  • C to T, chromosome 15 at 79,252,313 bp
  • T to C, chromosome 15 at 102,546,539 bp
  • A to G, chromosome 16 at 30,350,982 bp
  • C to A, chromosome 16 at 36,285,253 bp
  • T to A, chromosome 16 at 36,919,744 bp
  • C to T, chromosome 16 at 44,455,532 bp
  • T to C, chromosome 16 at 59,036,167 bp
  • C to A, chromosome 16 at 90,803,423 bp
  • A to T, chromosome 17 at 6,044,202 bp
  • A to G, chromosome 17 at 40,207,886 bp
  • T to G, chromosome 17 at 46,727,387 bp
  • T to A, chromosome 18 at 77,779,223 bp
  • A to G, chromosome 19 at 11,593,036 bp
  • A to T, chromosome 19 at 30,115,234 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8785 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068722-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.