Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8829Btlr/Mmmh
Stock Number:
068731-MU
Citation ID:
RRID:MMRRC_068731-MU
Other Names:
R8829 (G1)
Major Collection:

Strain Information

Kit
Name: Kit proto-oncogene receptor tyrosine kinase
Synonyms: Steel Factor Receptor, c-KIT, Dominant white spotting, belly-spot, Tr-kit, SOW3, SCO5, SCO1, Gsfsow3, Gsfsco5, Gsfsco1, CD117
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16590
HGNC: HGNC:6342
Homologene: 187
Cdk17
Name: cyclin dependent kinase 17
Synonyms: 6430598J10Rik, Pctk2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237459
VEGA: 10
HGNC: HGNC:8750
Homologene: 55666
Htr1d
Name: 5-hydroxytryptamine (serotonin) receptor 1D
Synonyms: Gpcr14, Htr1db
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15552
HGNC: HGNC:5289
Homologene: 20240
Gldc
Name: glycine decarboxylase
Synonyms: D19Wsu57e, D030049L12Rik, b2b2679Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104174
VEGA: 19
HGNC: HGNC:4313
Homologene: 141
Ncoa3
Name: nuclear receptor coactivator 3
Synonyms: pCIP, TRAM-1, AIB1, RAC3, TRAM1, Src3, 2010305B15Rik, KAT13B, bHLHe42
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17979
HGNC: HGNC:7670
Homologene: 4764
Odf2l
Name: outer dense fiber of sperm tails 2-like
Synonyms: 4733401D09Rik, 9630045K08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 52184
Homologene: 12011
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 58,255,490 bp
  • A to T, chromosome 1 at 58,548,673 bp
  • A to G, chromosome 1 at 107,515,527 bp
  • C to T, chromosome 1 at 173,183,891 bp
  • C to A, chromosome 2 at 25,626,133 bp
  • T to A, chromosome 2 at 34,838,622 bp
  • T to C, chromosome 2 at 53,157,915 bp
  • T to A, chromosome 2 at 66,483,617 bp
  • C to T, chromosome 2 at 118,823,741 bp
  • C to A, chromosome 2 at 158,216,936 bp
  • A to G, chromosome 2 at 166,050,148 bp
  • A to T, chromosome 3 at 60,031,819 bp
  • C to T, chromosome 3 at 94,993,033 bp
  • T to A, chromosome 3 at 103,152,404 bp
  • T to C, chromosome 3 at 138,349,702 bp
  • C to T, chromosome 3 at 145,128,059 bp
  • A to G, chromosome 3 at 157,567,786 bp
  • A to T, chromosome 4 at 32,562,028 bp
  • T to C, chromosome 4 at 83,000,194 bp
  • A to T, chromosome 4 at 136,443,243 bp
  • T to C, chromosome 5 at 14,788,450 bp
  • T to C, chromosome 5 at 23,844,049 bp
  • G to A, chromosome 5 at 38,319,735 bp
  • T to C, chromosome 5 at 62,814,265 bp
  • A to G, chromosome 5 at 75,639,131 bp
  • G to T, chromosome 5 at 95,483,080 bp
  • G to A, chromosome 6 at 77,605,222 bp
  • G to A, chromosome 7 at 23,893,839 bp
  • A to G, chromosome 7 at 29,697,844 bp
  • A to T, chromosome 7 at 44,114,853 bp
  • T to A, chromosome 7 at 68,226,021 bp
  • T to A, chromosome 7 at 100,850,272 bp
  • T to C, chromosome 7 at 105,288,228 bp
  • T to C, chromosome 8 at 46,573,461 bp
  • T to G, chromosome 8 at 61,940,661 bp
  • A to G, chromosome 8 at 83,938,829 bp
  • A to C, chromosome 8 at 122,491,014 bp
  • G to T, chromosome 9 at 38,930,894 bp
  • T to A, chromosome 9 at 40,187,913 bp
  • T to A, chromosome 9 at 46,281,046 bp
  • A to T, chromosome 9 at 73,010,351 bp
  • A to G, chromosome 9 at 108,840,383 bp
  • A to G, chromosome 9 at 110,380,203 bp
  • T to C, chromosome 9 at 111,347,523 bp
  • T to A, chromosome 9 at 121,754,264 bp
  • T to C, chromosome 10 at 5,108,685 bp
  • A to T, chromosome 10 at 21,145,231 bp
  • A to C, chromosome 10 at 51,615,199 bp
  • T to C, chromosome 10 at 82,738,345 bp
  • C to T, chromosome 10 at 93,207,058 bp
  • A to T, chromosome 10 at 102,378,223 bp
  • C to A, chromosome 10 at 108,642,332 bp
  • A to T, chromosome 10 at 127,201,168 bp
  • A to T, chromosome 11 at 9,621,881 bp
  • G to A, chromosome 11 at 40,721,672 bp
  • G to A, chromosome 11 at 53,532,038 bp
  • G to A, chromosome 11 at 75,670,246 bp
  • A to G, chromosome 11 at 78,267,238 bp
  • A to G, chromosome 11 at 85,171,211 bp
  • T to A, chromosome 11 at 87,803,424 bp
  • A to T, chromosome 11 at 99,614,420 bp
  • A to G, chromosome 11 at 109,455,106 bp
  • A to G, chromosome 12 at 115,495,914 bp
  • C to T, chromosome 13 at 25,110,068 bp
  • A to T, chromosome 13 at 54,718,117 bp
  • T to G, chromosome 13 at 111,752,481 bp
  • A to G, chromosome 13 at 112,989,705 bp
  • A to G, chromosome 14 at 70,048,467 bp
  • T to A, chromosome 15 at 82,855,714 bp
  • T to A, chromosome 15 at 103,478,815 bp
  • C to A, chromosome 17 at 46,446,895 bp
  • T to C, chromosome 17 at 48,249,837 bp
  • CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC to CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC, chromosome 18 at 75,471,803 bp
  • A to G, chromosome 19 at 4,601,940 bp
  • C to G, chromosome 19 at 30,100,812 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8829 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068731-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.