Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8847Btlr/Mmmh
Stock Number:
068735-MU
Citation ID:
RRID:MMRRC_068735-MU
Other Names:
R8847 (G1)
Major Collection:

Strain Information

Tle4
Name: transducin-like enhancer of split 4
Synonyms: Grg4, ESTM13, ESTM14, Bce1, 5730411M05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21888
VEGA: 19
Homologene: 38259
Clasp1
Name: CLIP associating protein 1
Synonyms: 5730583A19Rik, 1700030C23Rik, mCLASP1, CLASP1alpha, CLASP1, B130045P17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76707
Homologene: 41024
Ylpm1
Name: YLP motif containing 1
Synonyms: ZAP, Zap3, A930013E17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56531
Homologene: 87707
Slk
Name: STE20-like kinase
Synonyms: 9A2, mSLK, Etk4, SLK, Stk2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20874
Homologene: 22515
Map3k8
Name: mitogen-activated protein kinase kinase kinase 8
Synonyms: Cot, Tpl2, c-COT, Tpl-2, Cot/Tpl2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26410
HGNC: HGNC:6860
Homologene: 3812
Diaph1
Name: diaphanous related formin 1
Synonyms: p140mDia, Drf1, Dia1, D18Wsu154e, mDia1, Diap1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13367
HGNC: HGNC:2876
Homologene: 129567
Pkn2
Name: protein kinase N2
Synonyms: PRK2, 6030436C20Rik, Stk7, Prkcl2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109333
HGNC: HGNC:9406
Homologene: 2054
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 58,556,554 bp
  • A to T, chromosome 1 at 84,115,973 bp
  • C to G, chromosome 1 at 118,578,975 bp
  • A to G, chromosome 1 at 151,700,178 bp
  • G to T, chromosome 2 at 30,383,978 bp
  • G to A, chromosome 2 at 36,479,471 bp
  • C to T, chromosome 3 at 15,832,420 bp
  • C to A, chromosome 3 at 104,015,018 bp
  • A to G, chromosome 3 at 142,820,640 bp
  • T to A, chromosome 4 at 44,691,865 bp
  • T to A, chromosome 4 at 63,612,535 bp
  • T to C, chromosome 4 at 118,829,624 bp
  • T to A, chromosome 4 at 132,786,198 bp
  • C to T, chromosome 4 at 152,506,406 bp
  • C to T, chromosome 4 at 155,858,154 bp
  • C to T, chromosome 4 at 156,217,611 bp
  • C to T, chromosome 5 at 33,214,497 bp
  • A to T, chromosome 5 at 124,316,146 bp
  • G to T, chromosome 5 at 146,483,792 bp
  • G to A, chromosome 5 at 150,386,007 bp
  • T to C, chromosome 6 at 146,556,133 bp
  • A to G, chromosome 7 at 5,610,818 bp
  • G to A, chromosome 7 at 25,271,206 bp
  • T to C, chromosome 7 at 42,300,586 bp
  • A to T, chromosome 7 at 84,941,004 bp
  • G to C, chromosome 7 at 140,652,413 bp
  • A to C, chromosome 8 at 4,628,434 bp
  • T to C, chromosome 8 at 22,123,579 bp
  • G to C, chromosome 8 at 40,753,709 bp
  • A to G, chromosome 8 at 129,145,601 bp
  • C to A, chromosome 9 at 56,207,143 bp
  • A to G, chromosome 9 at 96,576,349 bp
  • C to A, chromosome 9 at 104,180,161 bp
  • A to T, chromosome 9 at 105,864,273 bp
  • A to T, chromosome 9 at 106,627,451 bp
  • C to T, chromosome 9 at 119,068,446 bp
  • A to G, chromosome 10 at 116,988,667 bp
  • T to C, chromosome 11 at 20,001,064 bp
  • A to G, chromosome 11 at 32,589,427 bp
  • T to G, chromosome 11 at 52,376,403 bp
  • A to T, chromosome 11 at 69,760,573 bp
  • C to T, chromosome 11 at 74,269,617 bp
  • A to T, chromosome 11 at 102,481,184 bp
  • CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG to CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG, chromosome 11 at 115,012,431 bp
  • C to A, chromosome 12 at 85,014,898 bp
  • T to A, chromosome 12 at 103,596,488 bp
  • C to T, chromosome 14 at 26,605,931 bp
  • C to T, chromosome 14 at 50,362,725 bp
  • T to A, chromosome 14 at 54,136,780 bp
  • T to C, chromosome 15 at 9,668,827 bp
  • A to C, chromosome 15 at 58,542,163 bp
  • T to C, chromosome 15 at 98,806,913 bp
  • A to G, chromosome 16 at 4,085,027 bp
  • A to T, chromosome 16 at 13,628,406 bp
  • T to A, chromosome 17 at 23,310,012 bp
  • A to G, chromosome 17 at 34,584,988 bp
  • T to A, chromosome 17 at 57,509,217 bp
  • T to A, chromosome 17 at 71,949,825 bp
  • A to G, chromosome 17 at 84,571,051 bp
  • A to T, chromosome 18 at 4,333,889 bp
  • A to G, chromosome 18 at 12,190,930 bp
  • A to T, chromosome 18 at 37,854,537 bp
  • T to C, chromosome 18 at 63,739,222 bp
  • T to A, chromosome 19 at 14,516,373 bp
  • G to A, chromosome 19 at 27,421,313 bp
  • T to A, chromosome 19 at 47,619,193 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8847 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068735-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.