Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8847Btlr/Mmmh
Stock Number:
068735-MU
Citation ID:
RRID:MMRRC_068735-MU
Other Names:
R8847 (G1)
Major Collection:

Strain Information

Tle4
Name: transducin-like enhancer of split 4
Synonyms: Grg4, ESTM13, ESTM14, Bce1, 5730411M05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21888
VEGA: 19
Homologene: 38259
Clasp1
Name: CLIP associating protein 1
Synonyms: 5730583A19Rik, 1700030C23Rik, mCLASP1, CLASP1alpha, CLASP1, B130045P17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76707
Homologene: 41024
Ylpm1
Name: YLP motif containing 1
Synonyms: ZAP, Zap3, A930013E17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56531
Homologene: 87707
Slk
Name: STE20-like kinase
Synonyms: 9A2, mSLK, Etk4, SLK, Stk2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20874
Homologene: 22515
Map3k8
Name: mitogen-activated protein kinase kinase kinase 8
Synonyms: Cot, Tpl2, c-COT, Tpl-2, Cot/Tpl2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26410
HGNC: HGNC:6860
Homologene: 3812
Diaph1
Name: diaphanous related formin 1
Synonyms: p140mDia, Drf1, Dia1, D18Wsu154e, mDia1, Diap1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13367
HGNC: HGNC:2876
Homologene: 129567
Pkn2
Name: protein kinase N2
Synonyms: PRK2, 6030436C20Rik, Stk7, Prkcl2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109333
HGNC: HGNC:9406
Homologene: 2054
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Spred2
Name: sprouty-related EVH1 domain containing 2
Synonyms: Spred-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 114716
Homologene: 24918
Wdr7
Name: WD repeat domain 7
Synonyms: TGF-beta resistance associated gene, TRAG
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 104082
VEGA: 18
Homologene: 11408
Parn
Name: poly(A)-specific ribonuclease (deadenylation nuclease)
Synonyms: DAN, 1200003I18Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74108
VEGA: 16
HGNC: HGNC:8609
Homologene: 31098
Pid1
Name: phosphotyrosine interaction domain containing 1
Synonyms: 5033414K04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98496
Homologene: 9924
Rasa2
Name: RAS p21 protein activator 2
Synonyms: GAP1m, 5430433H21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 114713
HGNC: HGNC:9872
Homologene: 4745
Vdac1
Name: voltage-dependent anion channel 1
Synonyms: Vdac5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22333
Homologene: 107244
Ints13
Name: integrator complex subunit 13
Synonyms: Spata30, 4933424B01Rik, Asun
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71177
Homologene: 10043
Cic
Name: capicua transcriptional repressor
Synonyms: 1200010B10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71722
Homologene: 87637
Crebbp
Name: CREB binding protein
Synonyms: CBP, KAT3A
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12914
HGNC: HGNC:2348
Homologene: 68393
Npc1
Name: NPC intracellular cholesterol transporter 1
Synonyms: D18Ertd723e, D18Ertd139e, C85354, lcsd, A430089E03Rik, nmf164
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18145
HGNC: HGNC:7897
Homologene: 228
Pum3
Name: pumilio RNA-binding family member 3
Synonyms: 1110069H02Rik, D19Bwg1357e
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52874
VEGA: 19
Homologene: 5762
Magi3
Name: membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms: 4732496O19Rik, 6530407C02Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99470
Homologene: 26431
Peak1
Name: pseudopodium-enriched atypical kinase 1
Synonyms: 1110049L02Rik, NKF3 kinase family member, C230081A13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244895
Homologene: 18259
Dennd6a
Name: DENN domain containing 6A
Synonyms: A630054L15Rik, Fam116a
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 211922
Homologene: 13503
Mphosph9
Name: M-phase phosphoprotein 9
Synonyms: 4930548D04Rik, MPP-9, MPP9, B930097C17Rik, 9630025B04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269702
HGNC: HGNC:7215
Homologene: 11256
Gpatch8
Name: G patch domain containing 8
Synonyms: 5430405G24Rik, Gpatc8, ENSMUSG00000075516, Fbm1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237943
Homologene: 46117
Dnajc13
Name: DnaJ heat shock protein family (Hsp40) member C13
Synonyms: Rme8, LOC382100, D030002L11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235567
Homologene: 13574
Stk10
Name: serine/threonine kinase 10
Synonyms: Lok, Gek1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20868
Homologene: 38122
Plekhh2
Name: pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213556
VEGA: 17
Homologene: 35317
Fer1l6
Name: fer-1 like family member 6
Synonyms: EG631797
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 631797
Homologene: 53396
Or1p1c
Name: olfactory receptor family 1 subfamily P member 1C
Synonyms: GA_x6K02T2P1NL-4415162-4416133, MOR133-1, Olfr406-ps, Olfr406
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258181
HGNC: HGNC:8222
Vmn2r61
Name: vomeronasal 2, receptor 61
Synonyms: Casr-rs2, EG637873, Gprc2a-rs2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637873
Homologene: 129683
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74183
Homologene: 135954
Adam25
Name: ADAM metallopeptidase domain 25
Synonyms: testase 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23793
HGNC: HGNC:199
Homologene: 128364
Or13a20
Name: olfactory receptor family 13 subfamily A member 20
Synonyms: IE12, MOR253-5, GA_x6K02T2PBJ9-42798103-42799038, Olfr53
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258962
Homologene: 133678
Col6a5
Name: collagen, type VI, alpha 5
Synonyms: Col6a5, Gm7455
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 665033
Homologene: 122792
Sirpb1c
Name: signal-regulatory protein beta 1C
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100038947
Homologene: 82993
Tlr11
Name: toll-like receptor 11
Synonyms: LOC239081
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239081
Homologene: 77905
Spef2
Name: sperm flagellar 2
Synonyms: C230086A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320277
Homologene: 23371
Ccdc7b
Name: coiled-coil domain containing 7B
Synonyms: 1700008F21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75453
Homologene: 49919
Vmn2r114
Name: vomeronasal 2, receptor 114
Synonyms: EG666002
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 666002
Homologene: 86604
Themis2
Name: thymocyte selection associated family member 2
Synonyms: ICB-1, BC013712
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230787
Homologene: 21009
Tex48
Name: testis expressed 48
Synonyms: 1700018C11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75524
Homologene: 87066
Ppp4r4
Name: protein phosphatase 4, regulatory subunit 4
Synonyms: 8430415E04Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74521
Homologene: 12571
Notch4
Name: notch 4
Synonyms: Int-3, Int3, N4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18132
HGNC: HGNC:7884
Homologene: 3351
Alk
Name: anaplastic lymphoma kinase
Synonyms: Tcrz, CD246
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11682
VEGA: 17
HGNC: HGNC:427
Homologene: 68387
Vmn1r61
Name: vomeronasal 1 receptor 61
Synonyms: Gm7186
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 636731
Homologene: 41799
Vmn2r120
Name: vomeronasal 2, receptor 120
Synonyms: EG224916
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224916
Niban1
Name: niban apoptosis regulator 1
Synonyms: Niban, Fam129a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 63913
Homologene: 62170
Nphp4
Name: nephronophthisis 4 (juvenile) homolog (human)
Synonyms: 4930564O18Rik, nmf192
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 260305
Homologene: 9024
Vill
Name: villin-like
Synonyms: Villp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22351
Homologene: 22650
Vmn2r65
Name: vomeronasal 2, receptor 65
Synonyms: ENSMUSG00000070600
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100009609
Or10ak11
Name: olfactory receptor family 10 subfamily AK member 11
Synonyms: GA_x6K02T2QD9B-18703033-18703986, MOR259-11, MOR259-6, Olfr1333
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258265
Homologene: 134082
Spon2
Name: spondin 2, extracellular matrix protein
Synonyms: M-spondin, Mindin, 2310045I24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100689
Homologene: 40843
Pax5
Name: paired box 5
Synonyms: Pax-5, EBB-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18507
HGNC: HGNC:8619
Homologene: 56419
Hycc2
Name: hyccin PI4KA lipid kinase complex subunit 2
Synonyms: D1Ertd53e, Fam126b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213056
Homologene: 18184
Nek5
Name: NIMA (never in mitosis gene a)-related expressed kinase 5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330721
HGNC: HGNC:7748
Homologene: 87952
Dvl1
Name: dishevelled segment polarity protein 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13542
Homologene: 20926
Best3
Name: bestrophin 3
Synonyms: mBest4, Vmd2l3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 382427
VEGA: 10
Homologene: 33850
Cd300ld2
Name: CD300 molecule like family member D2
Synonyms: Gm11709
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 629970
Miga2
Name: mitoguardin 2
Synonyms: R74766, 5730472N09Rik, Fam73b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108958
Homologene: 13125
Iqcf6
Name: IQ motif containing F6
Synonyms: 100041096
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100041096
Homologene: 67808
Or1j13
Name: olfactory receptor family 1 subfamily J member 13
Synonyms: GA_x6K02T2NLDC-33174915-33173974, MOR136-2, Olfr341
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258952
Homologene: 74160
Ddn
Name: dendrin
Synonyms: LOC328602
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13199
VEGA: 15
Homologene: 12816
Slc35g3
Name: solute carrier family 35, member G3
Synonyms: Amac1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56293
Homologene: 89413
Gm6408
Name: predicted gene 6408
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 623198
Homologene: 86127
Trdj2
Name: T cell receptor delta joining 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100118398
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 58,556,554 bp
  • A to T, chromosome 1 at 84,115,973 bp
  • C to G, chromosome 1 at 118,578,975 bp
  • A to G, chromosome 1 at 151,700,178 bp
  • G to T, chromosome 2 at 30,383,978 bp
  • G to A, chromosome 2 at 36,479,471 bp
  • C to T, chromosome 3 at 15,832,420 bp
  • C to A, chromosome 3 at 104,015,018 bp
  • A to G, chromosome 3 at 142,820,640 bp
  • T to A, chromosome 4 at 44,691,865 bp
  • T to A, chromosome 4 at 63,612,535 bp
  • T to C, chromosome 4 at 118,829,624 bp
  • T to A, chromosome 4 at 132,786,198 bp
  • C to T, chromosome 4 at 152,506,406 bp
  • C to T, chromosome 4 at 155,858,154 bp
  • C to T, chromosome 4 at 156,217,611 bp
  • C to T, chromosome 5 at 33,214,497 bp
  • A to T, chromosome 5 at 124,316,146 bp
  • G to T, chromosome 5 at 146,483,792 bp
  • G to A, chromosome 5 at 150,386,007 bp
  • T to C, chromosome 6 at 146,556,133 bp
  • A to G, chromosome 7 at 5,610,818 bp
  • G to A, chromosome 7 at 25,271,206 bp
  • T to C, chromosome 7 at 42,300,586 bp
  • A to T, chromosome 7 at 84,941,004 bp
  • G to C, chromosome 7 at 140,652,413 bp
  • A to C, chromosome 8 at 4,628,434 bp
  • T to C, chromosome 8 at 22,123,579 bp
  • G to C, chromosome 8 at 40,753,709 bp
  • A to G, chromosome 8 at 129,145,601 bp
  • C to A, chromosome 9 at 56,207,143 bp
  • A to G, chromosome 9 at 96,576,349 bp
  • C to A, chromosome 9 at 104,180,161 bp
  • A to T, chromosome 9 at 105,864,273 bp
  • A to T, chromosome 9 at 106,627,451 bp
  • C to T, chromosome 9 at 119,068,446 bp
  • A to G, chromosome 10 at 116,988,667 bp
  • T to C, chromosome 11 at 20,001,064 bp
  • A to G, chromosome 11 at 32,589,427 bp
  • T to G, chromosome 11 at 52,376,403 bp
  • A to T, chromosome 11 at 69,760,573 bp
  • C to T, chromosome 11 at 74,269,617 bp
  • A to T, chromosome 11 at 102,481,184 bp
  • CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG to CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG, chromosome 11 at 115,012,431 bp
  • C to A, chromosome 12 at 85,014,898 bp
  • T to A, chromosome 12 at 103,596,488 bp
  • C to T, chromosome 14 at 26,605,931 bp
  • C to T, chromosome 14 at 50,362,725 bp
  • T to A, chromosome 14 at 54,136,780 bp
  • T to C, chromosome 15 at 9,668,827 bp
  • A to C, chromosome 15 at 58,542,163 bp
  • T to C, chromosome 15 at 98,806,913 bp
  • A to G, chromosome 16 at 4,085,027 bp
  • A to T, chromosome 16 at 13,628,406 bp
  • T to A, chromosome 17 at 23,310,012 bp
  • A to G, chromosome 17 at 34,584,988 bp
  • T to A, chromosome 17 at 57,509,217 bp
  • T to A, chromosome 17 at 71,949,825 bp
  • A to G, chromosome 17 at 84,571,051 bp
  • A to T, chromosome 18 at 4,333,889 bp
  • A to G, chromosome 18 at 12,190,930 bp
  • A to T, chromosome 18 at 37,854,537 bp
  • T to C, chromosome 18 at 63,739,222 bp
  • T to A, chromosome 19 at 14,516,373 bp
  • G to A, chromosome 19 at 27,421,313 bp
  • T to A, chromosome 19 at 47,619,193 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8847 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068735-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.