Strain Name:
C57BL/6J-MtgxR8856Btlr/Mmmh
Stock Number:
068737-MU
Citation ID:
RRID:MMRRC_068737-MU
Other Names:
R8856 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Grm1
Name: glutamate receptor, metabotropic 1
Synonyms: mGluR1, Grm1, Gprc1a, nmf373, rcw, 4930455H15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14816
HGNC: HGNC:4593
Homologene: 649
Kcnmb4
Name: potassium large conductance calcium-activated channel, subfamily M, beta member 4
Synonyms: Slowpoke beta 4, 2900045G12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 58802
HGNC: HGNC:6289
Homologene: 8721
Rgs11
Name: regulator of G-protein signaling 11
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50782
HGNC: HGNC:9993
Homologene: 77719
Trmo
Name: tRNA methyltransferase O
Synonyms: 5830415F09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74753
Homologene: 32316
Manba
Name: mannosidase, beta A, lysosomal
Synonyms: Bmn, 2410030O07Rik, B930014J03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 110173
HGNC: HGNC:6831
Homologene: 4317
Stam2
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Synonyms: Hbp, 1200004O12Rik, 5730456G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56324
Homologene: 68490
Prdm5
Name: PR domain containing 5
Synonyms: 6530401I24Rik, E130112L17Rik, PFM2, 4432417F03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70779
HGNC: HGNC:9349
Homologene: 10274
Golga4
Name: golgin A4
Synonyms: golgin-245, Olp-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54214
HGNC: HGNC:4427
Homologene: 68224
Vcl
Name: vinculin
Synonyms: metavinculin
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22330
VEGA: 14
Homologene: 7594
Zc3h7b
Name: zinc finger CCCH type containing 7B
Synonyms: Scrg3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20286
VEGA: 15
Homologene: 9735
Ranbp9
Name: RAN binding protein 9
Synonyms: IBAP-1, RanBPM
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56705
VEGA: 13
Homologene: 38057
Nsf
Name: N-ethylmaleimide sensitive fusion protein
Synonyms: SKD2, N-ethylmaleimide sensitive factor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18195
HGNC: HGNC:8016
Homologene: 4502
Ubr1
Name: ubiquitin protein ligase E3 component n-recognin 1
Synonyms: E3 alpha
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22222
Homologene: 7582
Sec62
Name: SEC62 homolog, preprotein translocation
Synonyms: HTP1, Dtrp1, SEC62, 3100002M17Rik, Tloc1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69276
Homologene: 2449
Utp6
Name: UTP6 small subunit processome component
Synonyms: HCA66, 4732497O03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216987
Homologene: 41265
Lmtk2
Name: lemur tyrosine kinase 2
Synonyms: 2900041G10Rik, KPI-2, cprk, KPI2, A330101P12Rik, BREK, AATYK2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231876
Homologene: 8948
Fasn
Name: fatty acid synthase
Synonyms: FAS, A630082H08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14104
HGNC: HGNC:3594
Homologene: 55800
Slc45a4
Name: solute carrier family 45, member 4
Synonyms: 9330175B01Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 106068
Homologene: 69908
Nsmaf
Name: neutral sphingomyelinase (N-SMase) activation associated factor
Synonyms: Fan, factor associated with N-SMase activation
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18201
HGNC: HGNC:8017
Homologene: 2652
Iars2
Name: isoleucine-tRNA synthetase 2, mitochondrial
Synonyms: 2010002H18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381314
Homologene: 7118
Mrgpra1
Name: MAS-related GPR, member A1
Synonyms: MrgA1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233221
Homologene: 79615
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Ecel1
Name: endothelin converting enzyme-like 1
Synonyms: DINE, XCE
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13599
HGNC: HGNC:3147
Homologene: 3549
Ptgfrn
Name: prostaglandin F2 receptor negative regulator
Synonyms: CD9P-1, 4833445A08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19221
HGNC: HGNC:9601
Homologene: 7908
Lrrtm1
Name: leucine rich repeat transmembrane neuronal 1
Synonyms: 4632401D06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74342
Homologene: 41763
Htt
Name: huntingtin
Synonyms: huntingtin, HD, htt, IT15, C430023I11Rik, Hdh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15194
HGNC: HGNC:4851
Homologene: 1593
Hnrnpa2b1
Name: heterogeneous nuclear ribonucleoprotein A2/B1
Synonyms: Hnrpa2, 9130414A06Rik, Hnrpa2b1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 53379
HGNC: HGNC:5033
Homologene: 22992
Asph
Name: aspartate-beta-hydroxylase
Synonyms: cI-37, 2310005F16Rik, aspartyl beta-hydroxylase, calsequestrin-binding protein, Junctin, jumbug, BAH, 3110001L23Rik, junctate
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 65973
HGNC: HGNC:757
Homologene: 20910
Psmc6
Name: proteasome (prosome, macropain) 26S subunit, ATPase, 6
Synonyms: 2300001E01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67089
VEGA: 14
HGNC: HGNC:9553
Homologene: 100630
Fads1
Name: fatty acid desaturase 1
Synonyms: 0710001O03Rik, A930006B21Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76267
VEGA: 19
HGNC: HGNC:3574
Homologene: 22753
Tepsin
Name: TEPSIN, adaptor related protein complex 4 accessory protein
Synonyms: 2410002I01Rik, Enthd2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78777
Homologene: 35359
Rrm2b
Name: ribonucleotide reductase M2 B (TP53 inducible)
Synonyms: p53R2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 382985
Homologene: 56723
Eea1
Name: early endosome antigen 1
Synonyms: B230358H09Rik, ZFYVE2, A430109M19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216238
VEGA: 10
HGNC: HGNC:3185
Homologene: 37822
Slc44a3
Name: solute carrier family 44, member 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213603
Homologene: 64830
Irf4
Name: interferon regulatory factor 4
Synonyms: Spip, IRF-4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16364
HGNC: HGNC:6119
Homologene: 1842
Gpr155
Name: G protein-coupled receptor 155
Synonyms: DEPDC3, PGR22, 1110017O10Rik, F730029F15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68526
Homologene: 16584
Cacna1a
Name: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Synonyms: Cacnl1a4, alpha1A, Ccha1a, SCA6, nmf352, smrl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12286
HGNC: HGNC:1388
Homologene: 56383
Gnao1
Name: guanine nucleotide binding protein, alpha O
Synonyms: Go alpha, alphaO, Galphao
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14681
HGNC: HGNC:4389
Homologene: 39203
Frmd4b
Name: FERM domain containing 4B
Synonyms: 6030440G05Rik, GRSP1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232288
Homologene: 14916
Tspear
Name: thrombospondin type laminin G domain and EAR repeats
Synonyms: ORF65, C330046G03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 252974
HGNC: HGNC:1268
Homologene: 36972
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: Zfh-4, C130041O22Rik, Zfh4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80892
Homologene: 23477
Tnfrsf1a
Name: tumor necrosis factor receptor superfamily, member 1a
Synonyms: TNF receptor alpha chain, CD120a, TNF-R1, p55, TNF-R55, TNFRp55, Tnfr1, TNF-R-I, TNFR60, TNFAR, p55-R, TNFRI, TNF-alpha-R1, TNF-alphaR1, TNFalpha-R1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21937
Homologene: 828
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Dchs1
Name: dachsous cadherin related 1
Synonyms: C130033F22Rik, 3110041P15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233651
Homologene: 2771
Nek10
Name: NIMA (never in mitosis gene a)- related kinase 10
Synonyms: LOC238944
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 674895
Homologene: 130947
Abca4
Name: ATP-binding cassette, sub-family A member 4
Synonyms: Rim protein, RmP, Abc10, D430003I15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11304
HGNC: HGNC:34
Homologene: 298
Tecta
Name: tectorin alpha
Synonyms: [a]-tectorin, Tctna
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
Ralgapa2
Name: Ral GTPase activating protein, alpha subunit 2 (catalytic)
Synonyms: A230067G21Rik, RGC2, AS250
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241694
Homologene: 28131
Def6
Name: differentially expressed in FDCP 6
Synonyms: 2410003F05Rik, 6430538D02Rik, IRF-4-binding protein, IBP, SLAT
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 23853
HGNC: HGNC:2760
Homologene: 11103
Cpne8
Name: copine VIII
Synonyms: 1200003E11Rik, 1500031E20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66871
Homologene: 12049
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Mroh2b
Name: maestro heat-like repeat family member 2B
Synonyms: 4930455B06Rik, Heatr7b2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223825
VEGA: 15
Homologene: 128807
Cyp2j9
Name: cytochrome P450, family 2, subfamily j, polypeptide 9
Synonyms: 8430417E17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74519
HGNC: HGNC:2634
Homologene: 137388
Fbxl4
Name: F-box and leucine-rich repeat protein 4
Synonyms: FBL5, FBL4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269514
Homologene: 8128
Usp50
Name: ubiquitin specific peptidase 50
Synonyms: 1700086G18Rik, 4930511O11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75083
Homologene: 75281
Poteg
Name: POTE ankyrin domain family, member G
Synonyms: 4930456F22Rik, 4921537P18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70952
Homologene: 134158
A2m
Name: alpha-2-macroglobulin
Synonyms: A2mp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232345
HGNC: HGNC:7
Homologene: 37248
Slco1a1
Name: solute carrier organic anion transporter family, member 1a1
Synonyms: Oatp1, Slc21a1, Oatp1a1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28248
Homologene: 137261
Efna5
Name: ephrin A5
Synonyms: AL-1, RAGS, Ephrin-A5, Epl7, EFL-5, LERK-7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13640
HGNC: HGNC:3225
Homologene: 1482
Cacna1b
Name: calcium channel, voltage-dependent, N type, alpha 1B subunit
Synonyms: Cchn1a, alpha(1B), Cav2.2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12287
HGNC: HGNC:1389
Homologene: 20184
F13a1
Name: coagulation factor XIII, A1 subunit
Synonyms: Factor XIIIA, 1200014I03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74145
VEGA: 13
HGNC: HGNC:3531
Homologene: 20077
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Pcdhb8
Name: protocadherin beta 8
Synonyms: Pcdhb5C, PcdhbH
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93879
HGNC: HGNC:8690
Homologene: 89038
Fam83a
Name: family with sequence similarity 83, member A
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239463
Homologene: 13158
Fam149a
Name: family with sequence similarity 149, member A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212326
Homologene: 27540
Nell2
Name: NEL-like 2
Synonyms: mel91, A330108N19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54003
VEGA: 15
HGNC: HGNC:7751
Homologene: 4488
Hsf4
Name: heat shock transcription factor 4
Synonyms: ldis1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26386
HGNC: HGNC:5227
Homologene: 100128
Trim42
Name: tripartite motif-containing 42
Synonyms: 4930486B16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78911
Homologene: 12712
Mapkbp1
Name: mitogen-activated protein kinase binding protein 1
Synonyms: Jnkbp1, 2810483F24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26390
Homologene: 69109
Tecpr1
Name: tectonin beta-propeller repeat containing 1
Synonyms: 2210010N04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70381
Homologene: 9120
Agbl2
Name: ATP/GTP binding protein-like 2
Synonyms: A430081C19Rik, Ccp2, Ccp2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 271813
Homologene: 11715
Scai
Name: suppressor of cancer cell invasion
Synonyms: A930041I02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320271
Homologene: 15523
Mrpl34
Name: mitochondrial ribosomal protein L34
Synonyms: D8Bwg1484e, 0610007O17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94065
Homologene: 11401
Muc21
Name: mucin 21
Synonyms: epiglycanin, Gm9573
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 672682
Ecd
Name: ecdysoneless cell cycle regulator
Synonyms: 5730461K03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70601
VEGA: 14
Homologene: 5256
Itgb5
Name: integrin beta 5
Synonyms: [b]5B, [b]5A, [b]-5, beta-5, beta5, [b]5, ESTM23
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16419
HGNC: HGNC:6160
Homologene: 20511
Crocc2
Name: ciliary rootlet coiled-coil, rootletin family member 2
Synonyms: LOC381284, E030010N08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381284
Homologene: 141152
Fgf12
Name: fibroblast growth factor 12
Synonyms: Fhf1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14167
VEGA: 16
HGNC: HGNC:3668
Homologene: 10874
Rnf150
Name: ring finger protein 150
Synonyms: Greul5, A630007N06Rik, C030044C12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330812
Homologene: 33783
Vmn2r69
Name: vomeronasal 2, receptor 69
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330581
Homologene: 115466
Ly9
Name: lymphocyte antigen 9
Synonyms: T100, Lgp100, CD229, SLAMF3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17085
HGNC: HGNC:6730
Homologene: 1759
Or14j8
Name: olfactory receptor family 14 subfamily J member 8
Synonyms: GA_x6K02T2PSCP-2403971-2403000, MOR218-6P, MOR218-5P, MOR218-6P, MOR218-12, Olfr1552-ps1, Olfr761
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258094
Homologene: 134080
Marchf2
Name: membrane associated ring-CH-type finger 2
Synonyms: 9530046H09Rik, March2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224703
Homologene: 9539
Mmel1
Name: membrane metallo-endopeptidase-like 1
Synonyms: Nl1, NEPLP gamma, NEPLP beta, NEPLP alpha, SEP, Mell1, Nep2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 27390
Homologene: 22778
Galm
Name: galactose mutarotase
Synonyms: aldose 1-epimerase, A530057M15Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 319625
Homologene: 71795
Nde1
Name: nudE neurodevelopment protein 1
Synonyms: 2810027M15Rik, mNudE
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67203
Homologene: 32354
Tada2b
Name: transcriptional adaptor 2B
Synonyms: LOC231151
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231151
Homologene: 51007
Ldhc
Name: lactate dehydrogenase C
Synonyms: Ldh-3, Ldh3, Ldhc4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16833
HGNC: HGNC:6544
Homologene: 22767
Sgo2b
Name: shugoshin 2B
Synonyms: Gm4975, Sgol2b
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244495
Homologene: 51867
Gm43302
Name: predicted gene 43302
Type: Gene
Species: Mouse
Chromosome: 5
Gm45861
Name: predicted gene 45861
Type: Gene
Species: Mouse
Chromosome: 8
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 53,423,263 bp
  • A to C, chromosome 1 at 87,152,038 bp
  • A to T, chromosome 1 at 93,193,125 bp
  • G to A, chromosome 1 at 171,605,019 bp
  • A to G, chromosome 1 at 185,296,424 bp
  • C to T, chromosome 2 at 24,679,518 bp
  • T to C, chromosome 2 at 39,106,966 bp
  • G to T, chromosome 2 at 52,714,972 bp
  • A to T, chromosome 2 at 73,373,649 bp
  • A to G, chromosome 2 at 90,801,744 bp
  • T to C, chromosome 2 at 120,014,628 bp
  • A to T, chromosome 2 at 120,904,042 bp
  • A to G, chromosome 2 at 125,314,717 bp
  • C to A, chromosome 2 at 126,780,557 bp
  • G to T, chromosome 2 at 146,342,219 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • T to A, chromosome 3 at 5,390,424 bp
  • C to T, chromosome 3 at 30,793,357 bp
  • C to T, chromosome 3 at 101,056,611 bp
  • G to A, chromosome 3 at 121,513,807 bp
  • A to G, chromosome 3 at 122,112,447 bp
  • A to G, chromosome 3 at 135,518,003 bp
  • A to T, chromosome 4 at 6,433,320 bp
  • T to A, chromosome 4 at 9,630,947 bp
  • T to A, chromosome 4 at 22,390,803 bp
  • T to G, chromosome 4 at 46,387,625 bp
  • T to A, chromosome 4 at 96,573,947 bp
  • A to T, chromosome 4 at 143,726,733 bp
  • A to T, chromosome 4 at 154,885,021 bp
  • T to A, chromosome 5 at 34,903,331 bp
  • A to T, chromosome 5 at 36,483,822 bp
  • A to G, chromosome 5 at 105,290,873 bp
  • C to A, chromosome 5 at 144,176,261 bp
  • T to C, chromosome 5 at 144,216,299 bp
  • A to T, chromosome 6 at 51,466,140 bp
  • G to A, chromosome 6 at 65,883,585 bp
  • C to A, chromosome 6 at 77,244,824 bp
  • A to T, chromosome 6 at 97,292,398 bp
  • G to A, chromosome 6 at 121,641,390 bp
  • G to A, chromosome 6 at 125,357,725 bp
  • G to T, chromosome 6 at 141,911,898 bp
  • A to T, chromosome 7 at 46,876,575 bp
  • A to T, chromosome 7 at 47,335,835 bp
  • T to C, chromosome 7 at 85,412,455 bp
  • A to T, chromosome 7 at 105,760,857 bp
  • T to A, chromosome 8 at 27,448,005 bp
  • C to T, chromosome 8 at 27,520,760 bp
  • C to T, chromosome 8 at 45,381,574 bp
  • C to A, chromosome 8 at 63,940,057 bp
  • T to G, chromosome 8 at 71,465,380 bp
  • T to A, chromosome 8 at 83,036,086 bp
  • C to T, chromosome 8 at 84,559,441 bp
  • A to G, chromosome 8 at 93,811,417 bp
  • G to T, chromosome 8 at 105,269,996 bp
  • A to T, chromosome 9 at 42,373,301 bp
  • A to T, chromosome 9 at 97,363,222 bp
  • A to G, chromosome 9 at 118,556,711 bp
  • A to C, chromosome 10 at 10,719,348 bp
  • T to C, chromosome 10 at 12,667,607 bp
  • G to T, chromosome 10 at 77,829,637 bp
  • A to G, chromosome 10 at 95,995,644 bp
  • A to G, chromosome 10 at 116,446,394 bp
  • T to A, chromosome 11 at 79,951,629 bp
  • A to T, chromosome 11 at 103,930,742 bp
  • A to G, chromosome 11 at 120,091,828 bp
  • G to A, chromosome 11 at 120,818,153 bp
  • T to C, chromosome 13 at 30,761,431 bp
  • A to T, chromosome 13 at 36,916,885 bp
  • C to T, chromosome 13 at 43,414,030 bp
  • T to A, chromosome 13 at 81,559,502 bp
  • T to G, chromosome 14 at 14,937,610 bp
  • T to A, chromosome 14 at 20,337,072 bp
  • T to A, chromosome 14 at 20,995,092 bp
  • T to A, chromosome 14 at 45,340,863 bp
  • C to T, chromosome 15 at 4,931,028 bp
  • G to A, chromosome 15 at 37,960,614 bp
  • A to T, chromosome 15 at 58,009,581 bp
  • G to A, chromosome 15 at 73,586,117 bp
  • G to A, chromosome 15 at 81,772,480 bp
  • G to T, chromosome 15 at 90,601,841 bp
  • A to G, chromosome 15 at 95,383,671 bp
  • T to A, chromosome 16 at 14,183,582 bp
  • A to T, chromosome 16 at 28,189,481 bp
  • A to G, chromosome 16 at 33,900,592 bp
  • A to T, chromosome 17 at 26,204,510 bp
  • A to T, chromosome 17 at 28,216,998 bp
  • A to T, chromosome 17 at 33,696,191 bp
  • T to C, chromosome 17 at 35,620,973 bp
  • A to T, chromosome 17 at 37,952,200 bp
  • A to T, chromosome 17 at 62,607,379 bp
  • A to G, chromosome 17 at 80,183,232 bp
  • A to G, chromosome 18 at 37,356,723 bp
  • T to G, chromosome 19 at 10,192,912 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8856 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068737-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.