Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8856Btlr/Mmmh
Stock Number:
068737-MU
Citation ID:
RRID:MMRRC_068737-MU
Other Names:
R8856 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Grm1
Name: glutamate receptor, metabotropic 1
Synonyms: mGluR1, Grm1, Gprc1a, nmf373, rcw, 4930455H15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14816
HGNC: HGNC:4593
Homologene: 649
Kcnmb4
Name: potassium large conductance calcium-activated channel, subfamily M, beta member 4
Synonyms: Slowpoke beta 4, 2900045G12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 58802
HGNC: HGNC:6289
Homologene: 8721
Rgs11
Name: regulator of G-protein signaling 11
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50782
HGNC: HGNC:9993
Homologene: 77719
Trmo
Name: tRNA methyltransferase O
Synonyms: 5830415F09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74753
Homologene: 32316
Manba
Name: mannosidase, beta A, lysosomal
Synonyms: Bmn, 2410030O07Rik, B930014J03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 110173
HGNC: HGNC:6831
Homologene: 4317
Stam2
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Synonyms: Hbp, 1200004O12Rik, 5730456G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56324
Homologene: 68490
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 53,423,263 bp
  • A to C, chromosome 1 at 87,152,038 bp
  • A to T, chromosome 1 at 93,193,125 bp
  • G to A, chromosome 1 at 171,605,019 bp
  • A to G, chromosome 1 at 185,296,424 bp
  • C to T, chromosome 2 at 24,679,518 bp
  • T to C, chromosome 2 at 39,106,966 bp
  • G to T, chromosome 2 at 52,714,972 bp
  • A to T, chromosome 2 at 73,373,649 bp
  • A to G, chromosome 2 at 90,801,744 bp
  • T to C, chromosome 2 at 120,014,628 bp
  • A to T, chromosome 2 at 120,904,042 bp
  • A to G, chromosome 2 at 125,314,717 bp
  • C to A, chromosome 2 at 126,780,557 bp
  • G to T, chromosome 2 at 146,342,219 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • T to A, chromosome 3 at 5,390,424 bp
  • C to T, chromosome 3 at 30,793,357 bp
  • C to T, chromosome 3 at 101,056,611 bp
  • G to A, chromosome 3 at 121,513,807 bp
  • A to G, chromosome 3 at 122,112,447 bp
  • A to G, chromosome 3 at 135,518,003 bp
  • A to T, chromosome 4 at 6,433,320 bp
  • T to A, chromosome 4 at 9,630,947 bp
  • T to A, chromosome 4 at 22,390,803 bp
  • T to G, chromosome 4 at 46,387,625 bp
  • T to A, chromosome 4 at 96,573,947 bp
  • A to T, chromosome 4 at 143,726,733 bp
  • A to T, chromosome 4 at 154,885,021 bp
  • T to A, chromosome 5 at 34,903,331 bp
  • A to T, chromosome 5 at 36,483,822 bp
  • A to G, chromosome 5 at 105,290,873 bp
  • C to A, chromosome 5 at 144,176,261 bp
  • T to C, chromosome 5 at 144,216,299 bp
  • A to T, chromosome 6 at 51,466,140 bp
  • G to A, chromosome 6 at 65,883,585 bp
  • C to A, chromosome 6 at 77,244,824 bp
  • A to T, chromosome 6 at 97,292,398 bp
  • G to A, chromosome 6 at 121,641,390 bp
  • G to A, chromosome 6 at 125,357,725 bp
  • G to T, chromosome 6 at 141,911,898 bp
  • A to T, chromosome 7 at 46,876,575 bp
  • A to T, chromosome 7 at 47,335,835 bp
  • T to C, chromosome 7 at 85,412,455 bp
  • A to T, chromosome 7 at 105,760,857 bp
  • T to A, chromosome 8 at 27,448,005 bp
  • C to T, chromosome 8 at 27,520,760 bp
  • C to T, chromosome 8 at 45,381,574 bp
  • C to A, chromosome 8 at 63,940,057 bp
  • T to G, chromosome 8 at 71,465,380 bp
  • T to A, chromosome 8 at 83,036,086 bp
  • C to T, chromosome 8 at 84,559,441 bp
  • A to G, chromosome 8 at 93,811,417 bp
  • G to T, chromosome 8 at 105,269,996 bp
  • A to T, chromosome 9 at 42,373,301 bp
  • A to T, chromosome 9 at 97,363,222 bp
  • A to G, chromosome 9 at 118,556,711 bp
  • A to C, chromosome 10 at 10,719,348 bp
  • T to C, chromosome 10 at 12,667,607 bp
  • G to T, chromosome 10 at 77,829,637 bp
  • A to G, chromosome 10 at 95,995,644 bp
  • A to G, chromosome 10 at 116,446,394 bp
  • T to A, chromosome 11 at 79,951,629 bp
  • A to T, chromosome 11 at 103,930,742 bp
  • A to G, chromosome 11 at 120,091,828 bp
  • G to A, chromosome 11 at 120,818,153 bp
  • T to C, chromosome 13 at 30,761,431 bp
  • A to T, chromosome 13 at 36,916,885 bp
  • C to T, chromosome 13 at 43,414,030 bp
  • T to A, chromosome 13 at 81,559,502 bp
  • T to G, chromosome 14 at 14,937,610 bp
  • T to A, chromosome 14 at 20,337,072 bp
  • T to A, chromosome 14 at 20,995,092 bp
  • T to A, chromosome 14 at 45,340,863 bp
  • C to T, chromosome 15 at 4,931,028 bp
  • G to A, chromosome 15 at 37,960,614 bp
  • A to T, chromosome 15 at 58,009,581 bp
  • G to A, chromosome 15 at 73,586,117 bp
  • G to A, chromosome 15 at 81,772,480 bp
  • G to T, chromosome 15 at 90,601,841 bp
  • A to G, chromosome 15 at 95,383,671 bp
  • T to A, chromosome 16 at 14,183,582 bp
  • A to T, chromosome 16 at 28,189,481 bp
  • A to G, chromosome 16 at 33,900,592 bp
  • A to T, chromosome 17 at 26,204,510 bp
  • A to T, chromosome 17 at 28,216,998 bp
  • A to T, chromosome 17 at 33,696,191 bp
  • T to C, chromosome 17 at 35,620,973 bp
  • A to T, chromosome 17 at 37,952,200 bp
  • A to T, chromosome 17 at 62,607,379 bp
  • A to G, chromosome 17 at 80,183,232 bp
  • A to G, chromosome 18 at 37,356,723 bp
  • T to G, chromosome 19 at 10,192,912 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8856 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068737-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.